ID: 1134073759

View in Genome Browser
Species Human (GRCh38)
Location 16:11276446-11276468
Sequence CAGTAACACCAAGGGCAGGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 157}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134073759_1134073766 -5 Left 1134073759 16:11276446-11276468 CCCACCTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1134073766 16:11276464-11276486 TACTGTTGGTCTGGTCTGCAAGG 0: 1
1: 0
2: 1
3: 16
4: 141
1134073759_1134073775 23 Left 1134073759 16:11276446-11276468 CCCACCTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1134073775 16:11276492-11276514 CGGGAGCTTGTATATAAAGGGGG 0: 1
1: 0
2: 0
3: 2
4: 45
1134073759_1134073767 3 Left 1134073759 16:11276446-11276468 CCCACCTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1134073767 16:11276472-11276494 GTCTGGTCTGCAAGGCTCCCCGG 0: 1
1: 0
2: 5
3: 24
4: 188
1134073759_1134073768 4 Left 1134073759 16:11276446-11276468 CCCACCTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1134073768 16:11276473-11276495 TCTGGTCTGCAAGGCTCCCCGGG 0: 1
1: 0
2: 2
3: 11
4: 231
1134073759_1134073774 22 Left 1134073759 16:11276446-11276468 CCCACCTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1134073774 16:11276491-11276513 CCGGGAGCTTGTATATAAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 59
1134073759_1134073772 21 Left 1134073759 16:11276446-11276468 CCCACCTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1134073772 16:11276490-11276512 CCCGGGAGCTTGTATATAAAGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1134073759_1134073770 20 Left 1134073759 16:11276446-11276468 CCCACCTGCCCTTGGTGTTACTG 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1134073770 16:11276489-11276511 CCCCGGGAGCTTGTATATAAAGG 0: 1
1: 0
2: 0
3: 2
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134073759 Original CRISPR CAGTAACACCAAGGGCAGGT GGG (reversed) Exonic
901040135 1:6358650-6358672 CAGTAAGAGCCAGGCCAGGTGGG + Intronic
901507037 1:9691261-9691283 CAGTACCACCAAAGGGAGCTGGG + Intronic
904859471 1:33524452-33524474 CAATAACACTTAGTGCAGGTCGG - Intronic
907308061 1:53524598-53524620 CAGAGACACTAAGGGCAGGTGGG + Intronic
908987347 1:70039823-70039845 AAGTAACACTAAAGGCAGGAGGG - Intronic
909804171 1:79854228-79854250 CAGTAACCCCAAGGGCAGCTTGG + Intergenic
910621750 1:89262941-89262963 CAGTTCCACCAAGTGCAGGGTGG - Intronic
912384756 1:109265762-109265784 CAGTCACACAAGAGGCAGGTGGG - Exonic
923561986 1:235048506-235048528 CATTAAAACCAAGGGCAGCCGGG + Intergenic
924374733 1:243393352-243393374 CAGTAACAGATAGGGCAGCTGGG + Intronic
1065589819 10:27252719-27252741 CAGTAGCAGCCGGGGCAGGTGGG - Intergenic
1069608409 10:69755809-69755831 GAGTAACACCAATGGCTTGTTGG + Intergenic
1070264184 10:74886583-74886605 CTATAACACCAAGCTCAGGTGGG - Intronic
1073337660 10:102722379-102722401 CAGTAATATCAAGGACAGGAGGG - Intronic
1074674322 10:115831106-115831128 CTGGAAGAACAAGGGCAGGTGGG - Intronic
1076615222 10:131750436-131750458 CAGGCACACGGAGGGCAGGTGGG - Intergenic
1077426621 11:2482801-2482823 CAGGTGCACCAGGGGCAGGTGGG - Intronic
1079348560 11:19673889-19673911 CAGGAAAAGGAAGGGCAGGTGGG - Intronic
1083203276 11:61132557-61132579 CAGTGACAACAGGGGCAGCTGGG + Intronic
1083781968 11:64923431-64923453 CAGGGACACCAAGGGCCGGATGG + Intronic
1084449801 11:69229773-69229795 CAGTAACAGCACAGACAGGTGGG - Intergenic
1084512656 11:69615897-69615919 CTGTTACACCCAAGGCAGGTGGG - Intergenic
1088333653 11:108679151-108679173 CATTAACACCAGGGGAAGGCTGG - Intronic
1089759426 11:120712183-120712205 CACTACCCCCAAGGGCAGGCTGG - Intronic
1090261706 11:125325839-125325861 CAGTAACACTAAGTGAATGTGGG - Intronic
1090342862 11:126040892-126040914 CAGTAAAAACATGGGCAGGCTGG + Intronic
1093107295 12:15103974-15103996 CATTAACACCAAGGAAGGGTGGG - Intergenic
1095569202 12:43663865-43663887 CAGTGACCCAAAGGGCAGCTGGG - Intergenic
1095933904 12:47656467-47656489 CAGTAACACACAGGGTAGCTGGG - Intergenic
1100796660 12:98189257-98189279 CAGAAACACCAAGAGCAATTGGG + Intergenic
1101121124 12:101581285-101581307 CAGCAACAGCCAGGGCAGCTGGG + Intronic
1101547634 12:105731546-105731568 CAGACACAGCAATGGCAGGTTGG - Intergenic
1103864517 12:124041531-124041553 CGGTAAGACCAAGAGCAGCTAGG + Intronic
1104760589 12:131295573-131295595 CAGATCCACCAAGGGCAGGTGGG + Intergenic
1104819186 12:131665212-131665234 CAGATCCACCAAGGGCAGGTGGG - Intergenic
1106906484 13:34414743-34414765 CAGGAACACCAAAGTCAGCTTGG + Intergenic
1107819431 13:44272866-44272888 CAGTACCTCCAGGGGCAAGTAGG + Intergenic
1112092436 13:96095534-96095556 CAGTCACACCACCGGAAGGTTGG + Intronic
1112504511 13:99968247-99968269 CAGAAACACCAAGCGCGGGTTGG + Intronic
1116657692 14:47673403-47673425 GAGTGAAACCAAGGGCAAGTGGG + Intronic
1118381829 14:65223956-65223978 CAGTAAAAGCAACTGCAGGTTGG + Intergenic
1125094323 15:35833369-35833391 CAGTAAGACTTAGGGCATGTAGG + Intergenic
1126225927 15:46269070-46269092 CAGTCATACAAAGGGTAGGTAGG + Intergenic
1127975139 15:63991439-63991461 CAGTAGCAACAAGGTCAGGGAGG - Intronic
1128118494 15:65128533-65128555 CAGTGACATGAAGGGAAGGTGGG + Intronic
1129992771 15:79979173-79979195 CAGTAACAGCAAGCACAGCTGGG + Intergenic
1130780935 15:87040199-87040221 CAATAGCACAAAGGTCAGGTGGG + Intergenic
1132799087 16:1742674-1742696 CAGTAACACCACAGGGAGGCAGG + Intronic
1134073759 16:11276446-11276468 CAGTAACACCAAGGGCAGGTGGG - Exonic
1135525429 16:23210231-23210253 CAGCAACCACAAGGGGAGGTGGG + Intronic
1139574411 16:67832112-67832134 CAGAAACACCAAGGAGAGGGTGG + Intronic
1139870582 16:70105406-70105428 CAGTAGCACAAAGGGTGGGTAGG + Intergenic
1140384865 16:74527153-74527175 CAGTAGCACAAAGGGTGGGTAGG - Intronic
1140551359 16:75869692-75869714 CAGGGTCACCCAGGGCAGGTTGG + Intergenic
1141283573 16:82650703-82650725 CATGATCACCAAGGGCAGGAGGG - Intronic
1141370599 16:83482805-83482827 CACTAAGACCATGGGCAGGGTGG + Intronic
1141769204 16:86078852-86078874 CATTAACAGTAAGGGCAGGCCGG + Intergenic
1142736293 17:1902191-1902213 GTGTACCACCAAGGGCTGGTAGG + Intergenic
1142942877 17:3397661-3397683 CAGTGACACCACAGACAGGTGGG + Exonic
1143670478 17:8392817-8392839 CAGCAGCACCCAGGGCAGGATGG + Exonic
1144062178 17:11592622-11592644 CACTAACACAAGGGCCAGGTTGG + Intergenic
1144636119 17:16910310-16910332 TGGTAACATCAAGGGCAGGGGGG - Intergenic
1144645950 17:16973516-16973538 TGGTAACATCAAGGGCAGGGGGG + Intergenic
1146489575 17:33270619-33270641 CAGTAACACCACTGGCCGGCTGG - Intronic
1147989300 17:44323457-44323479 CAGTAAGACCTAGGGGAGGTGGG - Exonic
1151472477 17:74326693-74326715 CAGAAACGCCAGGGGCAGGGAGG + Intronic
1153032453 18:727718-727740 CAGTAACACAAAGGGTAGAGGGG - Intronic
1154485531 18:14868737-14868759 AGGTGACACCATGGGCAGGTGGG - Intergenic
1155572591 18:27211867-27211889 CAGAAACAACAAGGAGAGGTGGG - Intergenic
1157506905 18:48232953-48232975 CAGAAACAAGAAGGGCATGTAGG + Intronic
1158275142 18:55758707-55758729 CAGTAACATCATTGGCAGGAGGG - Intergenic
1161113587 19:2484001-2484023 AAGTACCAAGAAGGGCAGGTGGG - Intergenic
1161178821 19:2865879-2865901 CTGTAACCCCAAGGGAAGGGCGG + Intergenic
1161544839 19:4874147-4874169 CAGGAGCAGCAAGGGCAAGTTGG + Intergenic
1165758558 19:38307933-38307955 CAGTGACACCCAGAGCAGGCAGG + Intronic
1165806696 19:38584737-38584759 CAGGAACAGCACGGGCAGGGGGG - Intronic
1168104316 19:54157206-54157228 CAGTAACAGCAGGGGAAGGAGGG + Intronic
926055599 2:9772182-9772204 CAGAAGCACAAAGGGAAGGTGGG + Intergenic
927787120 2:25981890-25981912 CAGTAAGACCAAGGCCAGCGAGG - Exonic
928067014 2:28175201-28175223 CAGTAGCAGCAGGTGCAGGTAGG - Intronic
928297571 2:30097772-30097794 AAGCATCACTAAGGGCAGGTTGG - Intergenic
928401622 2:30983096-30983118 CAGTAACACCAAGGGCAGTGTGG - Intronic
931995503 2:67835526-67835548 CAGTGACCCCAAGAGCAGCTGGG - Intergenic
933686043 2:85141892-85141914 CAGGAAAACCAAGGGCAAGTTGG + Intronic
934960147 2:98665886-98665908 AAGAAATACCAAGAGCAGGTTGG + Intronic
935017619 2:99198997-99199019 CAGTTTCACCAAGGACAGTTTGG + Intronic
936236764 2:110748804-110748826 CAGTCACACAAATGACAGGTGGG - Intronic
938081822 2:128374252-128374274 CAGGAGCACCAAGGGCAGTGAGG + Intergenic
939962533 2:148578072-148578094 AAGAAACATCATGGGCAGGTCGG + Intergenic
941525840 2:166605964-166605986 CAGTCACTACAAGGGAAGGTGGG + Intergenic
941585220 2:167350289-167350311 CAGTAACACACAGGGTAGGCAGG - Intergenic
942011110 2:171763253-171763275 CAGAAACATCAAAAGCAGGTAGG + Intergenic
942517379 2:176768240-176768262 CTGTTTCTCCAAGGGCAGGTTGG + Intergenic
943735093 2:191345161-191345183 CAGTAACAGACTGGGCAGGTGGG + Intronic
944273668 2:197810645-197810667 CAGTAGCACCAAGGTAAGGTCGG - Intronic
949023153 2:241752682-241752704 CCGCACCACCAAGGGCAGTTGGG - Intronic
1170373000 20:15669810-15669832 CAGGGGCACAAAGGGCAGGTGGG + Intronic
1171456593 20:25276024-25276046 CGCTACCACCAAGGGCAGGAGGG - Intronic
1172522723 20:35578831-35578853 CAGGAGCTCCAGGGGCAGGTGGG - Intergenic
1173403329 20:42743975-42743997 CAGTGACTCCAACCGCAGGTGGG - Intronic
1176795804 21:13370739-13370761 AGGTGACACCATGGGCAGGTGGG + Intergenic
1178372390 21:32037322-32037344 TAGCAGCACCAAGGGCAGCTTGG + Intronic
1179575241 21:42304480-42304502 CATTGAGAGCAAGGGCAGGTAGG - Intergenic
1180289485 22:10783969-10783991 AGGTGACACCATGGGCAGGTGGG + Intergenic
1180305415 22:11068830-11068852 AGGTGACACCATGGGCAGGTGGG - Intergenic
1181631803 22:24155595-24155617 CTGTAACAGCAAGGACAGCTCGG + Intronic
1183786898 22:40034564-40034586 CAGGAACCCCAAGGACAGATGGG - Exonic
950420438 3:12895621-12895643 CAGAAACACCAAGGGGACATGGG + Intergenic
952544917 3:34408646-34408668 CAGTTACACCATGGGCAATTGGG + Intergenic
954622400 3:52003610-52003632 CAGGAACACCAATGGTAGGGAGG - Intergenic
962706362 3:138048660-138048682 GAGAAACACAAAGGGGAGGTGGG + Intergenic
963000616 3:140678410-140678432 CAGCAACACCAATGGCAGTTGGG - Exonic
963422418 3:145076669-145076691 CAATAAAACCAAGTCCAGGTTGG - Intergenic
963906608 3:150778736-150778758 CAGTAACACCCATGGGTGGTTGG + Intergenic
964857083 3:161158244-161158266 CAGAAACATGCAGGGCAGGTAGG - Intronic
974667014 4:64975771-64975793 CAGGAAAACCAAGGGCACTTTGG - Intergenic
975767515 4:77684479-77684501 CAGTAACAGGAGGGGGAGGTAGG - Intergenic
979507988 4:121519842-121519864 TAGAAACACCAAGAGTAGGTTGG - Intergenic
985033711 4:185818061-185818083 CAGTGACAGCACGTGCAGGTAGG + Intronic
985710379 5:1424461-1424483 CAGTGACACCATGGGCAGTGAGG - Intronic
986419886 5:7569201-7569223 AAGCAACACCTAAGGCAGGTGGG + Intronic
987315059 5:16716377-16716399 CAGGGACACCAAGAGCAGGGAGG + Intronic
989504051 5:42204817-42204839 CAGTAACACAAAGAGCTGGAGGG + Intergenic
991358750 5:65797959-65797981 CAGTAACAGAAAGAGCAGCTTGG + Intronic
995875776 5:116787813-116787835 CAGTGAGAGCAAGGGCAAGTTGG + Intergenic
996589211 5:125127048-125127070 AAGTACCCCCAAGGGCAGGCTGG - Intergenic
997406665 5:133654473-133654495 CACTAGCATCAAGGCCAGGTGGG + Intergenic
997601319 5:135140649-135140671 CAGAAACTCCAAGGGTGGGTGGG - Intronic
1001793588 5:174483037-174483059 CAGTAACATCCTGGGCAGGCAGG - Intergenic
1001980266 5:176033454-176033476 AGGTGACACCATGGGCAGGTGGG + Intronic
1002237117 5:177810209-177810231 AGGTGACACCATGGGCAGGTGGG - Intergenic
1002787101 6:410515-410537 TGTTACCACCAAGGGCAGGTAGG + Exonic
1003292308 6:4789750-4789772 GAGTAACACCCAGAGTAGGTGGG - Intronic
1004346135 6:14850852-14850874 CAGCGACACCAAGGGAAAGTGGG - Intergenic
1007641653 6:43345385-43345407 AAGAAATACCAAGGACAGGTAGG + Intronic
1008703070 6:54124848-54124870 CAGCAAAAGCATGGGCAGGTAGG + Exonic
1009035960 6:58117424-58117446 CAGTAACAGGCAGTGCAGGTGGG - Intergenic
1010233827 6:73558706-73558728 CAGAAACACAAAAGACAGGTCGG + Intergenic
1019142843 6:169959273-169959295 CAGTAGCAACAAGGGCACTTTGG + Intergenic
1019224711 6:170500398-170500420 CAGAAACAGCAGGGGCAGGGGGG - Intergenic
1024673442 7:51617234-51617256 CAGCAACAGCGAGGACAGGTAGG + Intergenic
1026569571 7:71517485-71517507 CAGTAAAATCAAGGTAAGGTGGG - Intronic
1027243165 7:76346645-76346667 CAAGAACGGCAAGGGCAGGTTGG - Intronic
1028938031 7:96487527-96487549 CTGTAATACAAAGGGCAGTTTGG + Intronic
1029060862 7:97796846-97796868 CAGTAAGAGTAAGGCCAGGTAGG - Intergenic
1030069782 7:105688708-105688730 CAGTAACAGCAAGGTCAAGGTGG + Intronic
1037761627 8:21745482-21745504 AAGTACCAGCAAAGGCAGGTTGG + Intronic
1043395203 8:79828686-79828708 CAGTAAAACTAATGGAAGGTTGG - Intergenic
1044449308 8:92314887-92314909 CAGGAACATCAATGGCAGCTTGG + Intergenic
1044466420 8:92512202-92512224 CAGTGATACGAAGGGCAGGGTGG - Intergenic
1045222210 8:100210518-100210540 CAGAAACACCAAGAGTAGTTTGG - Intronic
1046535267 8:115500867-115500889 CATTAAAACCAAGTTCAGGTCGG - Intronic
1047391311 8:124453841-124453863 CAGTAGCAGTAAGGACAGGTTGG + Intronic
1047446530 8:124925153-124925175 CTGGAACACCAAGGGCTGGCAGG - Intergenic
1049001434 8:139827741-139827763 AAGGAACACCTAGGGCAGGGTGG + Intronic
1049133578 8:140872525-140872547 CAGTCAGTCCAGGGGCAGGTGGG - Intronic
1049417932 8:142504057-142504079 CAGTAAGACCCAGGTCAGGCAGG + Intronic
1053886453 9:42647606-42647628 AGGTGACACCATGGGCAGGTGGG - Intergenic
1054225472 9:62455055-62455077 AGGTGACACCATGGGCAGGTGGG - Intergenic
1056480135 9:86994930-86994952 CAGTTATGCCAAGGGGAGGTGGG - Intergenic
1060658340 9:125388093-125388115 CAGGAAGACCAAGCGCAGGGTGG + Intergenic
1061236340 9:129344766-129344788 CAGAAAGAACAAGGGCTGGTGGG + Intergenic
1062175933 9:135162811-135162833 CGGTAACACCAAGGACAGAGGGG + Intergenic
1185848190 X:3459807-3459829 CAGTGACTCCAACGGCAAGTAGG + Intergenic
1188920263 X:35966773-35966795 CAGTAACAACAAAGCCAGGTGGG - Intronic
1190136376 X:47803209-47803231 CAGCGACAGCAAGGGCAGGCTGG - Intergenic
1190502679 X:51095392-51095414 TAGTAGCACCAAATGCAGGTAGG - Intergenic
1195536482 X:106013996-106014018 CAGTATCACCAAGTGTAGATGGG + Intergenic
1197483729 X:127020315-127020337 GAGAAACAGCAAGGGCAGGAAGG - Intergenic