ID: 1134075346

View in Genome Browser
Species Human (GRCh38)
Location 16:11287087-11287109
Sequence GGAAAAACTAAAGCAATCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 5, 3: 34, 4: 360}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134075346_1134075355 26 Left 1134075346 16:11287087-11287109 CCTCAGATTGCTTTAGTTTTTCC 0: 1
1: 0
2: 5
3: 34
4: 360
Right 1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 279
1134075346_1134075348 -2 Left 1134075346 16:11287087-11287109 CCTCAGATTGCTTTAGTTTTTCC 0: 1
1: 0
2: 5
3: 34
4: 360
Right 1134075348 16:11287108-11287130 CCTCAATGTTTTCCTGTTCCAGG 0: 1
1: 0
2: 2
3: 16
4: 238
1134075346_1134075354 25 Left 1134075346 16:11287087-11287109 CCTCAGATTGCTTTAGTTTTTCC 0: 1
1: 0
2: 5
3: 34
4: 360
Right 1134075354 16:11287135-11287157 CGTCTCCCTTTAGGCTCCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 128
1134075346_1134075351 16 Left 1134075346 16:11287087-11287109 CCTCAGATTGCTTTAGTTTTTCC 0: 1
1: 0
2: 5
3: 34
4: 360
Right 1134075351 16:11287126-11287148 CCAGGATCCCGTCTCCCTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 100

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134075346 Original CRISPR GGAAAAACTAAAGCAATCTG AGG (reversed) Intronic