ID: 1134075347

View in Genome Browser
Species Human (GRCh38)
Location 16:11287108-11287130
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 300}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134075347_1134075354 4 Left 1134075347 16:11287108-11287130 CCTCAATGTTTTCCTGTTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 300
Right 1134075354 16:11287135-11287157 CGTCTCCCTTTAGGCTCCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 128
1134075347_1134075351 -5 Left 1134075347 16:11287108-11287130 CCTCAATGTTTTCCTGTTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 300
Right 1134075351 16:11287126-11287148 CCAGGATCCCGTCTCCCTTTAGG 0: 1
1: 0
2: 1
3: 8
4: 100
1134075347_1134075355 5 Left 1134075347 16:11287108-11287130 CCTCAATGTTTTCCTGTTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 300
Right 1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134075347 Original CRISPR CCTGGAACAGGAAAACATTG AGG (reversed) Intronic