ID: 1134075349

View in Genome Browser
Species Human (GRCh38)
Location 16:11287120-11287142
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 170}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134075349_1134075355 -7 Left 1134075349 16:11287120-11287142 CCTGTTCCAGGATCCCGTCTCCC 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 279
1134075349_1134075354 -8 Left 1134075349 16:11287120-11287142 CCTGTTCCAGGATCCCGTCTCCC 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1134075354 16:11287135-11287157 CGTCTCCCTTTAGGCTCCTCTGG 0: 1
1: 0
2: 0
3: 7
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134075349 Original CRISPR GGGAGACGGGATCCTGGAAC AGG (reversed) Intronic