ID: 1134075355

View in Genome Browser
Species Human (GRCh38)
Location 16:11287136-11287158
Sequence GTCTCCCTTTAGGCTCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134075349_1134075355 -7 Left 1134075349 16:11287120-11287142 CCTGTTCCAGGATCCCGTCTCCC 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 279
1134075347_1134075355 5 Left 1134075347 16:11287108-11287130 CCTCAATGTTTTCCTGTTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 300
Right 1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 279
1134075346_1134075355 26 Left 1134075346 16:11287087-11287109 CCTCAGATTGCTTTAGTTTTTCC 0: 1
1: 0
2: 5
3: 34
4: 360
Right 1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134075355 Original CRISPR GTCTCCCTTTAGGCTCCTCT GGG Intronic