ID: 1134075355

View in Genome Browser
Species Human (GRCh38)
Location 16:11287136-11287158
Sequence GTCTCCCTTTAGGCTCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134075349_1134075355 -7 Left 1134075349 16:11287120-11287142 CCTGTTCCAGGATCCCGTCTCCC 0: 1
1: 0
2: 0
3: 10
4: 170
Right 1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 279
1134075346_1134075355 26 Left 1134075346 16:11287087-11287109 CCTCAGATTGCTTTAGTTTTTCC 0: 1
1: 0
2: 5
3: 34
4: 360
Right 1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 279
1134075347_1134075355 5 Left 1134075347 16:11287108-11287130 CCTCAATGTTTTCCTGTTCCAGG 0: 1
1: 0
2: 1
3: 26
4: 300
Right 1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG 0: 1
1: 0
2: 1
3: 41
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134075355 Original CRISPR GTCTCCCTTTAGGCTCCTCT GGG Intronic
900795493 1:4705792-4705814 GTGTCTCGTTTGGCTCCTCTTGG - Intronic
901422472 1:9160410-9160432 CTCTCCCATTGGGCTCCTCCCGG - Intergenic
902975862 1:20088046-20088068 TTGTCTCTTTAGGCTCCTCTTGG - Intronic
903410790 1:23141332-23141354 GTATCCCTTGAGCCTCCTGTGGG + Intronic
907114864 1:51959621-51959643 GTGTCTCCTTAGGCTCTTCTGGG - Intronic
907283382 1:53365232-53365254 GTGTCTCCCTAGGCTCCTCTTGG - Intergenic
908659322 1:66420588-66420610 GTCTATCTTAAGGCCCCTCTGGG - Intergenic
910219076 1:84872032-84872054 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
910219182 1:84873095-84873117 ATGTCTCCTTAGGCTCCTCTTGG - Intronic
910900764 1:92118237-92118259 CTGTCTCCTTAGGCTCCTCTTGG + Intronic
912141480 1:106734665-106734687 ATATTCCTTTAAGCTCCTCTTGG - Intergenic
912774976 1:112501047-112501069 GTGTCTCCTTAGGCGCCTCTTGG + Intronic
915273996 1:154775582-154775604 GTTTCCCTTCAGGATCCTCATGG - Intronic
915636589 1:157191254-157191276 ATACCTCTTTAGGCTCCTCTGGG + Intergenic
916373539 1:164126377-164126399 GTCTCCCATTAGGCTACTTGGGG + Intergenic
917341776 1:173986868-173986890 ATATCTCTTTAAGCTCCTCTTGG + Intronic
917466517 1:175282301-175282323 ATGTCCCCTTAGGTTCCTCTTGG - Intergenic
918857938 1:189782616-189782638 GTCTGCCTTCAGGCTCTCCTTGG + Intergenic
919154885 1:193751159-193751181 TTCTCTTTTTAGGCACCTCTGGG - Intergenic
920052002 1:203169953-203169975 GTCACCCTTTAGGTTCCCTTCGG + Intronic
921968974 1:221123862-221123884 ATGTCTCTTTAGGCGCCTCTTGG + Intergenic
922077107 1:222255465-222255487 GTGTCTCCCTAGGCTCCTCTTGG - Intergenic
924223556 1:241902604-241902626 GCCTCCCTTCAGGCTCCTGCAGG + Intergenic
924677751 1:246197608-246197630 GTGTTGCTTTAGGCTTCTCTTGG - Intronic
1063018790 10:2105227-2105249 ATGTCCCCTTAGGCTGCTCTTGG - Intergenic
1064351875 10:14584243-14584265 GTGTCTCTTTAGGGTCCTATAGG - Intronic
1065681275 10:28235134-28235156 GTCTCTCATTAAGCTTCTCTTGG - Intronic
1066691621 10:38034314-38034336 ATGTCTCTTTAGGCTCCTCTTGG + Intronic
1067001079 10:42614348-42614370 ATGTCTCTTTAGGCTCCTCTTGG - Intronic
1067355878 10:45525903-45525925 GTATCTCCTTAGGCTCCTCTTGG - Intronic
1067540597 10:47149316-47149338 ACATCTCTTTAGGCTCCTCTTGG - Intergenic
1068714099 10:60168488-60168510 GTGTCTCCTTAGGTTCCTCTGGG + Intronic
1070938272 10:80319151-80319173 ATGTCCCTTCAGGCTCCTCTTGG - Intergenic
1070955682 10:80461840-80461862 GTATCTCTTTCTGCTCCTCTCGG - Intronic
1072315709 10:94200977-94200999 ATGCCTCTTTAGGCTCCTCTTGG - Intronic
1072617091 10:97057119-97057141 CTGTCCCTTTAGGCCTCTCTTGG - Intronic
1073548999 10:104380093-104380115 TTCTCCCTCCAGGTTCCTCTTGG - Exonic
1073909182 10:108321070-108321092 GTCTCACTTTTGGGTCCACTGGG - Intergenic
1074261436 10:111857423-111857445 GGCCTCCTTTAGGCTCCTCTTGG + Intergenic
1074298064 10:112209452-112209474 GACTCCCATCAGGCTCCCCTTGG - Intronic
1075933466 10:126319585-126319607 GTGTCTCTGAAGGCTCCTCTTGG - Intronic
1077390505 11:2298793-2298815 GGGTCCCTTTAGACTCCCCTGGG + Intronic
1078890305 11:15549695-15549717 CTATCTCCTTAGGCTCCTCTTGG + Intergenic
1079210886 11:18459774-18459796 GTATCTCCTTGGGCTCCTCTAGG + Intronic
1080006762 11:27416508-27416530 GTCTCCTTTTAGTCTGGTCTTGG - Intronic
1080077892 11:28173741-28173763 ATGTCCCTTTAGCTTCCTCTTGG + Intronic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1084577014 11:69995510-69995532 ATGACTCTTTAGGCTCCTCTTGG + Intergenic
1084643019 11:70437165-70437187 CTCTCACGTTAGGCTCCTGTGGG - Intergenic
1086254655 11:84861464-84861486 ATATCCCTTAAGCCTCCTCTAGG - Intronic
1086413006 11:86560815-86560837 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1087451830 11:98333110-98333132 GTATCTCCTTAGGCTCTTCTTGG + Intergenic
1088183420 11:107137358-107137380 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1089363516 11:117907004-117907026 GTCTCCCTCCAGGCTCCAATAGG - Intronic
1089397986 11:118148344-118148366 GTCTCCTATGAGGCTGCTCTGGG + Intronic
1090052219 11:123389492-123389514 TTATCTCCTTAGGCTCCTCTTGG - Intergenic
1091045317 11:132319838-132319860 GCCTCCCGTTAGGCTACTCGGGG - Intronic
1091682487 12:2537056-2537078 GCCTCCCTGCCGGCTCCTCTGGG - Intronic
1092139049 12:6170223-6170245 ATGTCTCTGTAGGCTCCTCTTGG - Intergenic
1092174181 12:6391427-6391449 GACTCCCTTTCCTCTCCTCTAGG - Exonic
1097006512 12:55922855-55922877 ATGTCTCTTTAAGCTCCTCTTGG - Intronic
1100083894 12:90883696-90883718 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1100202007 12:92309010-92309032 ATGTCGCTTTAGGCTCCTCTTGG + Intergenic
1100373916 12:93994782-93994804 CTCTCCCTTTCTGCACCTCTTGG + Intergenic
1100975554 12:100118467-100118489 ATGTCTTTTTAGGCTCCTCTTGG - Intronic
1101599567 12:106197444-106197466 GTGTTTCTTTAGGCTCCTCTGGG + Intergenic
1103395337 12:120602668-120602690 TTCTCCCTTCAGTCTCCTCCCGG + Intergenic
1104080859 12:125429553-125429575 GTGTCTCCTGAGGCTCCTCTTGG + Intronic
1104124788 12:125835994-125836016 GGGTCTCCTTAGGCTCCTCTTGG + Intergenic
1105657136 13:22453829-22453851 ATCTCGTCTTAGGCTCCTCTGGG - Intergenic
1106127985 13:26916396-26916418 ATGTCTCCTTAGGCTCCTCTGGG + Intergenic
1106737935 13:32607481-32607503 GTCTCCAGTTAGGCTACTCGGGG + Intronic
1109036863 13:57274270-57274292 CTGTCTCTTTTGGCTCCTCTTGG - Intergenic
1109477565 13:62902717-62902739 TTCTGTCTTTAGGCTCCTCTTGG + Intergenic
1110338414 13:74360018-74360040 GTCTCTCCTTAAGCTCCCCTGGG + Intergenic
1111775113 13:92651536-92651558 ATGTCTCTATAGGCTCCTCTTGG - Intronic
1113202467 13:107882243-107882265 ATCTTCTTGTAGGCTCCTCTTGG + Intergenic
1113241947 13:108347791-108347813 CTGTCCCTTTAGGCTCCTTGTGG + Intergenic
1113437980 13:110307679-110307701 GCCTCCCGTTAGGCCCCTGTGGG - Intronic
1114467240 14:22931758-22931780 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
1114483595 14:23049662-23049684 GTCTCCTTTCAAGGTCCTCTGGG - Exonic
1114749894 14:25191714-25191736 GTGTCTCATTAGGCTCTTCTTGG + Intergenic
1119332815 14:73807848-73807870 GTATCTCCTTAGGCTTCTCTTGG - Intergenic
1119750001 14:77070445-77070467 GGCCCCCTTTAGGCTCTGCTGGG - Intergenic
1120861763 14:89261165-89261187 CTCTCCTTTTAGGTTCCTTTTGG - Intronic
1121677214 14:95763256-95763278 ACGTCCCCTTAGGCTCCTCTTGG - Intergenic
1122184959 14:99985044-99985066 ATATCTCTTTAGGCTCCTCTTGG + Intronic
1123404147 15:20010412-20010434 AGCTCCCTTCAGGCTCCTCCTGG - Intergenic
1123513485 15:21017058-21017080 AGCTCCCTTCAGGCTCCTCCTGG - Intergenic
1125763429 15:42115477-42115499 GTCACGTCTTAGGCTCCTCTTGG + Intergenic
1125772009 15:42174654-42174676 GTCTCAGTTTAGGTCCCTCTTGG - Intronic
1125985911 15:44051653-44051675 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1126611734 15:50536792-50536814 CTCTCTATTTAGGTTCCTCTTGG - Intronic
1127176075 15:56359077-56359099 ATATCTCTTTAAGCTCCTCTTGG + Intronic
1128771549 15:70286359-70286381 GGCTCACATTAGGATCCTCTGGG - Intergenic
1131780131 15:95846966-95846988 GGCTCCCTTGGGGCTCCTCGTGG - Intergenic
1132190408 15:99851151-99851173 ATGTCTCTATAGGCTCCTCTTGG + Intergenic
1132317856 15:100902930-100902952 GTGTCCCTTTTGGCCCCTCAGGG + Intronic
1132721749 16:1319999-1320021 GTCTTCCTTTAGTCTCCTCATGG + Intronic
1132775840 16:1593552-1593574 GTGTCTCCTCAGGCTCCTCTGGG + Intronic
1133894039 16:9908607-9908629 TTCTCCCTTTACTCTCCTGTTGG - Intronic
1134075355 16:11287136-11287158 GTCTCCCTTTAGGCTCCTCTGGG + Intronic
1135947288 16:26876390-26876412 GTCTCCATTTAGGGTCATCAAGG - Intergenic
1139018651 16:62721047-62721069 GTATCTCTTTAGGCTCCTGTTGG + Intergenic
1141267126 16:82507443-82507465 GGCTCCCTCTAGGGGCCTCTGGG + Intergenic
1141385256 16:83616699-83616721 GGCTCCATTTATGCTGCTCTTGG - Intronic
1142113419 16:88344178-88344200 GTGTCTCCTTCGGCTCCTCTGGG - Intergenic
1144842455 17:18196161-18196183 GACTCCTCTTAGACTCCTCTTGG + Intronic
1147349879 17:39833995-39834017 TTGTCTCCTTAGGCTCCTCTTGG + Intronic
1147358252 17:39914378-39914400 ATGTCTCCTTAGGCTCCTCTTGG - Intronic
1147558244 17:41493271-41493293 GTCTCTTTTTATGCTTCTCTGGG + Intergenic
1147965540 17:44192549-44192571 CTCTCCCTCTGGCCTCCTCTCGG + Exonic
1149309030 17:55376319-55376341 CTGTCTCCTTAGGCTCCTCTTGG - Intergenic
1150107223 17:62471095-62471117 CTCTGCCTTTAGTTTCCTCTTGG - Intronic
1150373225 17:64660216-64660238 GTTTCCATTTACCCTCCTCTGGG - Intronic
1151193574 17:72415980-72416002 CTCTCCCTTTCTGCTCTTCTCGG + Intergenic
1153691692 18:7600795-7600817 GTCTTCCTCTAGGCACCTCTTGG - Intronic
1154347519 18:13555138-13555160 GTGTCTCCTTAGGCTCCTCTTGG - Intronic
1155601525 18:27554148-27554170 ATGTCTCTTTAGGCTTCTCTTGG - Intergenic
1155715626 18:28940059-28940081 GTGACCCCTTAGGCTCCTCTAGG - Intergenic
1155847099 18:30721672-30721694 GTCTCCCTTCTACCTCCTCTGGG + Intergenic
1156618895 18:38824995-38825017 ATTTCTCTTTAGGTTCCTCTTGG - Intergenic
1157149402 18:45200977-45200999 ATGTCTCTTTAGGCTTCTCTTGG + Intergenic
1157374045 18:47146886-47146908 GGCTCCCTTTGCGCTCCTCTTGG - Intronic
1157945733 18:51978446-51978468 GTGTCTCCTTAGCCTCCTCTTGG - Intergenic
1158308606 18:56134328-56134350 AACACCCTTTATGCTCCTCTGGG + Intergenic
1158732987 18:60046195-60046217 ATGTCTGTTTAGGCTCCTCTTGG - Intergenic
1159778080 18:72626743-72626765 GTCTTCCTTTTGGCTCCTTCTGG - Intronic
1159821190 18:73146805-73146827 GTGTCTCCTTAAGCTCCTCTTGG + Intergenic
1164412022 19:28014167-28014189 GTCTTCCTTTAGACTCTGCTAGG + Intergenic
1166059252 19:40315048-40315070 GTGTCTCCTTAGGTTCCTCTTGG - Intergenic
925781051 2:7382191-7382213 GTGTCCCCTTATGCACCTCTTGG - Intergenic
927121447 2:19967979-19968001 ATGTCTCCTTAGGCTCCTCTGGG + Intronic
927975507 2:27335510-27335532 GTCTCCCTGGAAACTCCTCTGGG - Intronic
928617094 2:33051638-33051660 GTTGCCCTTGAGGCTGCTCTTGG + Intronic
929820659 2:45271051-45271073 GTCTCCCTGTCGGCTCCTTAGGG + Intergenic
930002969 2:46873661-46873683 CTCTCCCTCCAGGCTCCTCTGGG + Intergenic
930182990 2:48383557-48383579 GTGTCTCTTTAGGGTCCTTTTGG - Intergenic
931257326 2:60584923-60584945 GGCTCCCCTTGGGCTCCCCTTGG + Intergenic
931318543 2:61154371-61154393 ATGTCTCCTTAGGCTCCTCTTGG - Intronic
931425613 2:62168460-62168482 TTATCTCCTTAGGCTCCTCTTGG - Intergenic
931649878 2:64457784-64457806 ATGTCCCCTTGGGCTCCTCTTGG + Intronic
931709379 2:64975033-64975055 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
931811352 2:65857889-65857911 GTATCCCTTTAGACTGCTGTGGG + Intergenic
932843309 2:75105907-75105929 ATGTCTCTTTAGGCTCCTCTTGG - Intronic
933139610 2:78777746-78777768 GTCTACTTTGAGGGTCCTCTTGG - Intergenic
933540481 2:83634963-83634985 ATGTCTCTTTAGGCTCCTCTTGG - Intergenic
934657506 2:96123770-96123792 GTCTACCTCTTGGCTCCTTTGGG - Intergenic
935479826 2:103572515-103572537 GTGTCTTCTTAGGCTCCTCTTGG - Intergenic
935727324 2:106035139-106035161 GTGTCTCCTTTGGCTCCTCTTGG - Intergenic
937888393 2:126916048-126916070 GTCTCCGTGAGGGCTCCTCTGGG + Intergenic
938074860 2:128326303-128326325 GTCTGCCCTTAGGAGCCTCTGGG - Intergenic
938178113 2:129154862-129154884 CTCTCTCCTTAGGCTCTTCTTGG + Intergenic
938861985 2:135378890-135378912 ATGTCTCTTTAGGCTTCTCTGGG - Intronic
939872240 2:147538501-147538523 TTCTCCCTTTAGTCTCCTCTAGG + Intergenic
940225656 2:151398695-151398717 GCTTCCCTTTTGGCTCCTCAAGG + Intergenic
940294338 2:152106674-152106696 ATATCCCCTTAGGCTCCTTTTGG - Intergenic
941411042 2:165157281-165157303 ATGTCTTTTTAGGCTCCTCTTGG + Intronic
942928278 2:181458184-181458206 GTCTCGCTTTAGGCTCCTAGTGG + Exonic
942979163 2:182058184-182058206 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
942980183 2:182071225-182071247 ATGTCTCCTTAGGCTCCTCTGGG + Intronic
944116224 2:196189692-196189714 ATATCTCATTAGGCTCCTCTTGG + Intergenic
944929495 2:204501746-204501768 GTGTCCATTTAATCTCCTCTTGG + Intergenic
946799147 2:223391657-223391679 GTGTCTCCTTAGGCTCCTCTTGG + Intergenic
947921363 2:233877623-233877645 ATGTCTCTTTAGGCTCCTCTTGG + Intergenic
948050616 2:234976848-234976870 GTGTCTCTTTAAGCTCCTCTTGG - Intronic
1168755203 20:311765-311787 GTGTCTCTCTGGGCTCCTCTTGG + Intergenic
1169386625 20:5155517-5155539 GTCTCCCTTCTGGCTTCTGTTGG + Intronic
1169418239 20:5436315-5436337 ATGTTCCCTTAGGCTCCTCTTGG + Intergenic
1174500500 20:50980875-50980897 GTCTCCCTCGAGGGTCCTGTTGG - Intergenic
1174722319 20:52826211-52826233 ATGTCTCTTTAGGTTCCTCTTGG + Intergenic
1175068682 20:56312869-56312891 CCCTGCCTTCAGGCTCCTCTAGG + Intergenic
1175649983 20:60712398-60712420 GTCTCTCTTTAATCTCCTTTTGG + Intergenic
1177306817 21:19329098-19329120 CTCTCTCCTTAGGCTCCTTTTGG + Intergenic
1179566742 21:42253613-42253635 GTTTCCCTTTAGGGTTCCCTAGG - Intronic
1180739744 22:18044902-18044924 GTCTCCCTACACTCTCCTCTTGG - Intergenic
1180850712 22:19018690-19018712 GTCTGCATTTAGGCCCCTGTGGG - Intergenic
1182746262 22:32607810-32607832 GTCTCCCATGAGGATCCTCCTGG + Intronic
1184427180 22:44417795-44417817 GTATCTCCTTGGGCTCCTCTTGG + Intergenic
1184456478 22:44613218-44613240 ATGTCCCATTAGGTTCCTCTGGG - Intergenic
1185417437 22:50717967-50717989 TGCTCCTTTTTGGCTCCTCTTGG + Intergenic
949739929 3:7220525-7220547 TTGTCTCCTTAGGCTCCTCTTGG - Intronic
949832999 3:8236500-8236522 ATGTCTCTTTAGGTTCCTCTTGG - Intergenic
950413245 3:12852837-12852859 GCCACCCCTTTGGCTCCTCTTGG - Intronic
951396422 3:22173198-22173220 GTATTTCTTTAGGCTCCACTGGG - Intronic
951528159 3:23673308-23673330 TTGTCTCTTTAGGCTCCTCTTGG + Intergenic
954775138 3:53010335-53010357 GTCTCCCTTTGTCCTCCCCTGGG - Intronic
955240748 3:57175992-57176014 GTATCTCCTTAGGCTCCCCTTGG + Intergenic
955312305 3:57901262-57901284 GTCTCCCTGTGGGGTCCTCAAGG - Intronic
957679908 3:83420387-83420409 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
959156142 3:102668260-102668282 TTAGCACTTTAGGCTCCTCTGGG + Intergenic
960226321 3:115173626-115173648 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
960250977 3:115453094-115453116 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
960350046 3:116581329-116581351 GTTTCCATTAAGTCTCCTCTGGG + Intronic
960856171 3:122104296-122104318 TTTTCCCTTCAGCCTCCTCTAGG + Intronic
961239079 3:125394617-125394639 GTCTCATTTTAGGATCCTGTGGG + Intergenic
961675429 3:128562314-128562336 GTCGTGCTTGAGGCTCCTCTGGG + Intergenic
962955312 3:140260777-140260799 ATATCTCTTTAGGCTTCTCTTGG + Intronic
963203413 3:142607750-142607772 GTGTCTCCTTAGGCTCCCCTTGG + Intronic
963492852 3:146022546-146022568 GTGTCTCCTTAGGCTCCTCTGGG - Intergenic
964758726 3:160113548-160113570 GTGTCTCTTTAGCTTCCTCTTGG - Intergenic
964876488 3:161373105-161373127 ATCTACCTTTAGCTTCCTCTGGG - Intergenic
965512125 3:169579815-169579837 CTCTCTCTTTAGGCTGCTGTTGG - Intronic
967297425 3:187978983-187979005 CTCTCCCTTTATTCTCCCCTGGG - Intergenic
968625719 4:1625827-1625849 GTCTCCCCCAAGGCTCCACTTGG - Intronic
969915139 4:10483235-10483257 TTCTCTCTTGAGGCCCCTCTGGG + Intergenic
969953117 4:10860464-10860486 ATATCTCTTTAGCCTCCTCTTGG + Intergenic
972190179 4:36581642-36581664 ATGTCTCTGTAGGCTCCTCTGGG - Intergenic
972221160 4:36956960-36956982 GAGTCTCTTTAGGCTTCTCTTGG + Intergenic
972990379 4:44816333-44816355 ATGTCTCTTTAGGCTACTCTAGG + Intergenic
973130433 4:46641659-46641681 ATGTCTCTTTAGGCTCCTCTTGG + Intergenic
974352005 4:60760583-60760605 ATATACCATTAGGCTCCTCTTGG - Intergenic
975221562 4:71818450-71818472 GTCTCATTGTTGGCTCCTCTTGG + Intergenic
975234291 4:71973261-71973283 ATGTGTCTTTAGGCTCCTCTTGG + Intergenic
976920064 4:90428867-90428889 ATATCTCCTTAGGCTCCTCTTGG - Intronic
977117356 4:93047208-93047230 ATATCTCTTTATGCTCCTCTTGG - Intronic
978288928 4:107113936-107113958 ATGTCTCTCTAGGCTCCTCTTGG - Intronic
979508952 4:121529748-121529770 ATCTCCCTTCAGGATCCTCCTGG + Intergenic
979785470 4:124712062-124712084 GGCTCCCCTGTGGCTCCTCTGGG - Intronic
980188386 4:129491971-129491993 ATGTCTCTTTAGGCTCCTCTTGG + Intergenic
981087552 4:140699661-140699683 ATATCCCGTTAGGCTCCTCTGGG - Intronic
983238748 4:165207862-165207884 GTCTCCATTGTGGCTCCTCTCGG - Intronic
984256317 4:177393651-177393673 GTCCCCATCTAGGCTACTCTGGG + Intergenic
984687685 4:182689937-182689959 GTCCATCTTTAGGCTTCTCTGGG - Intronic
985817546 5:2137804-2137826 GCCTCCCTTTGCGCTCCTCAGGG + Intergenic
986578566 5:9238229-9238251 CTCTCCCTTAAGCCTCGTCTGGG - Intronic
987600016 5:20055963-20055985 GTCTAACTTTAGGGTCCTTTTGG + Intronic
987867584 5:23565746-23565768 GTGTCCCATGAGGTTCCTCTTGG + Intergenic
990508293 5:56466529-56466551 GTCTGCCTCTAGGCTCCCCCTGG - Intronic
992773219 5:80068560-80068582 GTCTGCCTTGACGCTCCTGTTGG + Intronic
993475590 5:88360340-88360362 TTGTCTCTTTAGGCTCCTCATGG + Intergenic
993945523 5:94113083-94113105 TGGTCTCTTTAGGCTCCTCTTGG - Intergenic
994211928 5:97096545-97096567 GTCTGCCTTTATGATCCTTTCGG + Intronic
994238139 5:97389849-97389871 ATGTTCCTTTAGGGTCCTCTTGG + Intergenic
994301032 5:98147694-98147716 CTGTCTCTTCAGGCTCCTCTTGG + Intergenic
994555480 5:101295389-101295411 GCATCTCCTTAGGCTCCTCTTGG - Intergenic
994916565 5:105988052-105988074 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
995870909 5:116742440-116742462 CTCTCACTTGAGGCTCCTATAGG - Intergenic
995872049 5:116754225-116754247 ATGTCTCTTTAGGTTCCTCTTGG + Intergenic
997586337 5:135045798-135045820 GTGCCTCTTTAGGCTCCTCATGG - Intronic
997701721 5:135906731-135906753 ATGTCTCTTTAAGCTCCTCTTGG + Intergenic
998190120 5:140016570-140016592 GTCTCCCTATAAGCTCCTGAGGG - Intronic
999054744 5:148562353-148562375 GGCTCCTTTTAGGCTCTTATAGG - Intronic
1001032228 5:168271355-168271377 GTTTCCCATTAGACTCCTCCTGG - Intergenic
1002210782 5:177597890-177597912 GTGTCTCCTTAGGCTCCTTTTGG + Intergenic
1002942633 6:1731781-1731803 GTGTCACTTCATGCTCCTCTGGG - Intronic
1003463903 6:6358847-6358869 GTATCTCCTCAGGCTCCTCTGGG + Intergenic
1005523480 6:26622446-26622468 ATATCTCCTTAGGCTCCTCTTGG + Intergenic
1006882334 6:37351270-37351292 GTGTCTCCTTAGGCTCCTCTTGG - Intergenic
1007117779 6:39356046-39356068 GTGTCTCCCTAGGCTCCTCTTGG + Intronic
1007851899 6:44811164-44811186 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1008264069 6:49402212-49402234 TTGTCTCTTTAGGCTCCTTTTGG - Intergenic
1010064750 6:71669141-71669163 GTGTCTCCTTAGGCTCCTCCTGG + Intergenic
1010200974 6:73281824-73281846 ATGTCTCCTTAGGCTCCTCTTGG + Intronic
1010925725 6:81743582-81743604 ATGTCTCTTTAGGCTCCTCTTGG + Intronic
1010942158 6:81931629-81931651 GTCTCCCTTTAGGTTTTCCTAGG - Intergenic
1011713356 6:90077844-90077866 GTCTCCCTTTAACCTCCTCCAGG - Intronic
1012143733 6:95655536-95655558 ATGTCTTTTTAGGCTCCTCTTGG - Intergenic
1012783505 6:103592819-103592841 ATGTCCCTTTAAGTTCCTCTAGG + Intergenic
1012923304 6:105242539-105242561 GTGTCTCTTTAGTGTCCTCTCGG + Intergenic
1012942972 6:105435987-105436009 ATGTCTCTTTAGGGTCCTCTTGG + Intergenic
1014616931 6:123614014-123614036 GTCACCCTTTAAGATGCTCTAGG + Intronic
1014860962 6:126468087-126468109 CTATCTCTTTAGGCTCCACTTGG - Intergenic
1014913911 6:127121337-127121359 GTTTGCCTTTTGACTCCTCTCGG - Intronic
1018413628 6:163582049-163582071 CTCTCCCTTTAGGCTTTCCTGGG + Intergenic
1020988871 7:15170807-15170829 ATGTCTCTTTAGGCCCCTCTTGG + Intergenic
1021440618 7:20670120-20670142 ATGTCGCCTTAGGCTCCTCTTGG - Intronic
1021874318 7:25034287-25034309 GTGTCTCCTTAGGCTCCTCTTGG + Intergenic
1021887872 7:25157702-25157724 ATCTCTCCTTAGGTTCCTCTTGG - Intronic
1022328953 7:29359904-29359926 CTCTCCCTGGAGGCTCCCCTGGG + Intronic
1022634501 7:32119332-32119354 GCCTCACTTCAGGCTCCTGTTGG + Intronic
1023110802 7:36808749-36808771 CTCTCACTTTTGGCTCCTCTCGG + Intergenic
1024318528 7:48043359-48043381 GTCTCCCTGTAGTTGCCTCTGGG - Intronic
1026080079 7:67210129-67210151 AATTCTCTTTAGGCTCCTCTTGG + Intronic
1026697013 7:72603898-72603920 AGTTCTCTTTAGGCTCCTCTTGG - Intronic
1027945264 7:84736951-84736973 ATGTCTCTTTAGGCGCCTCTTGG + Intergenic
1028085354 7:86629775-86629797 GTGTTTCTTTAGGCTCCTCTTGG + Intergenic
1029336491 7:99904408-99904430 GTCTCTCCTTAGGTGCCTCTTGG - Intronic
1029635218 7:101779105-101779127 GTGTCCCTTCTGGCTCATCTAGG + Intergenic
1031297802 7:120026029-120026051 ATGTCCCCTTAGGCTCCTCTTGG + Intergenic
1032036269 7:128523644-128523666 CTCTGCCTTTAGTTTCCTCTTGG - Intergenic
1033526477 7:142219328-142219350 TTCTCCCTCTAGGCTCTTCTGGG + Intronic
1034582547 7:152057922-152057944 GTGTCTCCTTAGGCTCTTCTTGG + Intronic
1036821485 8:11943190-11943212 GGCTCCCTGGAGGCTGCTCTGGG - Intergenic
1038756801 8:30349277-30349299 TTGTCTCCTTAGGCTCCTCTTGG + Intergenic
1039559218 8:38499292-38499314 ATGTCCCCTCAGGCTCCTCTTGG + Intergenic
1041088093 8:54275307-54275329 GTGTCTCTTTAGGCTCCTCCTGG + Intergenic
1041440690 8:57893195-57893217 ATGTCTCCTTAGGCTCCTCTTGG + Intergenic
1041761549 8:61372674-61372696 ATGTTTCTTTAGGCTCCTCTTGG + Intronic
1041828671 8:62127369-62127391 ATATCTCTTTAGGCTCCTCCTGG - Intergenic
1042226638 8:66519755-66519777 ATCCCCCTTTGGGCTCCTCTGGG - Intergenic
1043338550 8:79207988-79208010 ATATCTCTTTAGGTTCCTCTTGG + Intergenic
1043432318 8:80206961-80206983 TTATCCTTTTAGGCTCCTATGGG + Intronic
1047050801 8:121110457-121110479 GTATCCCCCTTGGCTCCTCTAGG + Intergenic
1048053905 8:130846111-130846133 GGCTCCCTGTAGTCTCTTCTAGG - Intronic
1048548362 8:135407774-135407796 ATGTCTCTTTATGCTCCTCTTGG + Intergenic
1048934938 8:139347085-139347107 GACTCACTATAGTCTCCTCTTGG + Intergenic
1050835504 9:10073424-10073446 ATGTCTCTGTAGGCTCCTCTTGG - Intronic
1051261145 9:15265946-15265968 ATGTCCCCTTAGGCTCCTCTTGG - Intronic
1051493121 9:17689283-17689305 GTATCTCATTAGACTCCTCTTGG - Intronic
1052171955 9:25410305-25410327 GAATCCCTTTATGCTGCTCTTGG - Intergenic
1054764321 9:69030627-69030649 GGCTCCCTTTAGGGTCCCTTGGG - Intergenic
1058527736 9:105877160-105877182 ATATCTCCTTAGGCTCCTCTTGG - Intergenic
1058534011 9:105936223-105936245 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1059809325 9:117838341-117838363 GTCTCTCCTCAGGCTCCTCTGGG + Intergenic
1061623145 9:131824588-131824610 GTCTCCCTCTAAGCTCCAGTAGG - Intergenic
1061875221 9:133540174-133540196 GTCTCCGTTTGGGATCGTCTAGG - Intronic
1186424150 X:9450357-9450379 GTATCACCTTGGGCTCCTCTGGG + Intergenic
1187743205 X:22378984-22379006 GTGTCTCCTTAGGCACCTCTAGG + Intergenic
1188350344 X:29122532-29122554 GTTTCCCTTTAGGCTCATGATGG - Intronic
1188541484 X:31255472-31255494 ATTTCCCATTAGACTCCTCTGGG - Intronic
1189162594 X:38825744-38825766 ATGTCTCTTTAGGCTTCTCTTGG - Intergenic
1190043348 X:47090333-47090355 ATCTGCCTTTAGGCACCTCCTGG - Intronic
1192607902 X:72538978-72539000 TTGTCTCCTTAGGCTCCTCTTGG - Intronic
1192734592 X:73837439-73837461 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1194096882 X:89652079-89652101 ATTTCTCTTTAGGGTCCTCTTGG + Intergenic
1194829224 X:98599981-98600003 GTGTCACATTAAGCTCCTCTTGG - Intergenic
1195524005 X:105865009-105865031 GCCCCCCTTCAGGCTCCTGTTGG + Intronic
1197650928 X:129062807-129062829 GTGTCTCTTTGGGTTCCTCTTGG - Intergenic
1199116798 X:144001861-144001883 TTCCCCCTTTAGCCTGCTCTAGG + Intergenic
1199584288 X:149397101-149397123 ATGTCTCCTTAGGCTCCTCTTGG - Intergenic
1200449903 Y:3313451-3313473 ATTTCTCTTTAGGGTCCTCTTGG + Intergenic