ID: 1134078513

View in Genome Browser
Species Human (GRCh38)
Location 16:11308886-11308908
Sequence CTGGGTCCACAGCTGCAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 3, 2: 25, 3: 81, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134078510_1134078513 -5 Left 1134078510 16:11308868-11308890 CCAAGAGTGCAGGGATGCCTGGG 0: 24
1: 92
2: 139
3: 195
4: 1227
Right 1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG 0: 1
1: 3
2: 25
3: 81
4: 286
1134078508_1134078513 -2 Left 1134078508 16:11308865-11308887 CCACCAAGAGTGCAGGGATGCCT 0: 28
1: 66
2: 123
3: 210
4: 1026
Right 1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG 0: 1
1: 3
2: 25
3: 81
4: 286
1134078506_1134078513 4 Left 1134078506 16:11308859-11308881 CCTGGGCCACCAAGAGTGCAGGG 0: 1
1: 21
2: 76
3: 513
4: 14459
Right 1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG 0: 1
1: 3
2: 25
3: 81
4: 286
1134078502_1134078513 26 Left 1134078502 16:11308837-11308859 CCTGTGAGGGGAGGGGGGTCTTC 0: 1
1: 0
2: 10
3: 33
4: 285
Right 1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG 0: 1
1: 3
2: 25
3: 81
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134078513 Original CRISPR CTGGGTCCACAGCTGCAATT TGG Intronic
900717787 1:4156384-4156406 CTGGGACCACAGCGGACATTAGG - Intergenic
901041079 1:6363937-6363959 CTGGGACCACAGGTGCAGCTGGG - Intronic
901936498 1:12630551-12630573 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
903464890 1:23545219-23545241 CTGGAGCCACAGCTGCAAGGTGG + Intergenic
903703469 1:25267849-25267871 CTGGGTTCACAGCTGGACGTCGG - Intronic
903712736 1:25338178-25338200 CTGGGTTCACAGCTGGACGTCGG - Exonic
904369991 1:30042315-30042337 CTGGGTCTACAGCTGTGGTTTGG - Intergenic
904443686 1:30550700-30550722 CTGGGTCTGCAGCTGCAACTTGG - Intergenic
905633393 1:39531640-39531662 GTGGGCCCACAGCTGCACTTGGG + Intergenic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
906132539 1:43469163-43469185 CTGGGTCCACAGCTATAGCTTGG + Intergenic
906477902 1:46182146-46182168 CTGGGTACACATCTGCTAGTGGG - Intronic
906494854 1:46297709-46297731 CTGGGTTCACAGGAGCAATATGG + Intronic
907369744 1:53993035-53993057 CTGGGTCCACAGCCACAGTTTGG + Intergenic
907761711 1:57367943-57367965 CTGGGTCCACAGCTGTGGTTTGG - Intronic
907828978 1:58045884-58045906 CAGGGAGCAGAGCTGCAATTTGG - Intronic
909197665 1:72648403-72648425 CTTGGTTCACAGCTGCAGCTGGG - Intergenic
911539969 1:99146468-99146490 CTGGATCCACAACTGCAATTTGG - Intergenic
911948517 1:104141007-104141029 ATGTGTTCACAGCTGCAAATTGG + Intergenic
915751212 1:158212764-158212786 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
915828853 1:159106174-159106196 CTGGGTCCGGAGCTGCAGCTGGG + Intronic
916360638 1:163963308-163963330 CTGGGTCCAGAGATGCTATCTGG - Intergenic
917257276 1:173129166-173129188 CTGGGTCCACAGTTCCAATTGGG - Intergenic
919453891 1:197801034-197801056 CTGGGTTCGCAGTTGCAACTTGG - Intergenic
921680000 1:218020314-218020336 CAGGGTCTACAGCTGAATTTTGG + Intergenic
923328050 1:232898229-232898251 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
924679830 1:246220452-246220474 CTGGATCCACAGCTGTGGTTTGG - Intronic
1062770135 10:92528-92550 CTGGGTCCACAGCCGTGGTTTGG + Intergenic
1062771556 10:105186-105208 CTGGGTCCACAGCCACGGTTTGG + Intergenic
1064010216 10:11729757-11729779 CTGGGTCCACAGCTGTGGCTGGG - Intergenic
1064093799 10:12407689-12407711 CTTGGACCACAGCTGGAAATGGG - Intronic
1066101627 10:32122948-32122970 CTAGGTCTGCAGCTGCAGTTTGG + Intergenic
1067149032 10:43714619-43714641 CTGGGTCCTCAGCTTCTAATAGG + Intergenic
1069121703 10:64576523-64576545 CTGGGTCCACAGCCACAGCTGGG - Intergenic
1070401493 10:76056805-76056827 CTGGGTCTGCAGCTGCAGCTGGG + Intronic
1071639129 10:87288266-87288288 CTGTTTCCTCAGCTGCAATTGGG - Intergenic
1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG + Intergenic
1071886151 10:89952292-89952314 CTGAGTCCACAGCTGTGGTTTGG + Intergenic
1072154852 10:92715055-92715077 TTGCGTCCACAGCTGCAGTTTGG + Intergenic
1072754948 10:98013294-98013316 CAGGCACCACATCTGCAATTTGG + Intronic
1073260849 10:102188991-102189013 CTGGGTCTGCAGCCCCAATTTGG + Intergenic
1074028646 10:109663236-109663258 CTAGGTCTGCAGCTGCAACTTGG - Intergenic
1075740282 10:124691777-124691799 CTGGGTCCCCCACTGCAAGTGGG + Intronic
1075782573 10:125026686-125026708 CTGCCTCCGCAGCTGCATTTCGG + Exonic
1076655261 10:132019557-132019579 CTGGGTCCACAGCCACAGTTTGG + Intergenic
1076659206 10:132044161-132044183 CTGGGCCCTCAGCTGCCCTTAGG + Intergenic
1077096942 11:803062-803084 CTTGGTCCACAGCTGCCTCTTGG - Intronic
1077564752 11:3290506-3290528 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1077570642 11:3336323-3336345 CTGGCTCCACAGCTGCTGCTGGG + Intergenic
1078303217 11:10156035-10156057 CCGGGTCCAGAGCTGCAGCTGGG - Intronic
1078315311 11:10289342-10289364 CTGGGTCCACAGCTCTGACTTGG + Intronic
1079114088 11:17629475-17629497 CTGGGGCCAAAGCTGCCAGTAGG + Intronic
1079472440 11:20790733-20790755 CTGGGTCTGTAGCTGCAAGTGGG + Intronic
1080333817 11:31174074-31174096 CTGGGTCTGCAGCTGCAGCTGGG - Intronic
1080333838 11:31174164-31174186 CTGGGTCTGCAGCTGCAGCTGGG - Intronic
1080499580 11:32856963-32856985 CTGGGACCACAGGTGCACCTCGG + Exonic
1080852069 11:36078624-36078646 CTGCATCTGCAGCTGCAATTTGG + Intronic
1081678106 11:44982793-44982815 CATGGTCCACAGATGCAACTGGG - Intergenic
1081830098 11:46102777-46102799 TTGGGCCCTCAGCTGGAATTTGG - Intronic
1084991044 11:72925939-72925961 TTGGATCCACAGCTGCAGATTGG - Intronic
1085548184 11:77340648-77340670 CACGGCACACAGCTGCAATTTGG + Exonic
1086085193 11:82946082-82946104 CCAGGTCCACAGCTGCAGTTTGG + Intronic
1087038024 11:93773636-93773658 CTGAGTCCACAGCCCCAACTTGG + Intronic
1087427081 11:98003081-98003103 GTGGGTACACAGTTTCAATTAGG + Intergenic
1088651028 11:111958313-111958335 CTGGGTCCACAGCTGTGGCTTGG - Intronic
1088704397 11:112448347-112448369 CTGGATCCACAGCTGCAGCTTGG + Intergenic
1088769043 11:113014877-113014899 CTGGATCCAGAGCTGCTATCTGG + Intronic
1089063231 11:115643103-115643125 CTGTGTCCAGGGCTGCACTTAGG + Intergenic
1089322323 11:117634732-117634754 CTAGGTCCCCAGCTGCAAGGTGG + Intronic
1089388035 11:118080579-118080601 CTGGGTTCTCAGCTGCACTGAGG - Intronic
1089505938 11:118961807-118961829 CTGGGTCTGCAGCTGCGTTTGGG + Intergenic
1091825309 12:3507951-3507973 CTGGGTCAACAGCTTTAATGTGG - Intronic
1092754793 12:11753236-11753258 CTCAGTCCTCAGCTGCAACTTGG + Intronic
1093450887 12:19312312-19312334 CTGGCTCCAAAGCTTCAAATAGG - Intronic
1093493104 12:19726519-19726541 CTGGGTTCACAGCTGCTGTTTGG + Intergenic
1093493182 12:19726871-19726893 CAGGGTCCACAGCTGCAGCTTGG + Intergenic
1094410550 12:30164029-30164051 CTGTGATCACATCTGCAATTGGG + Intergenic
1094427185 12:30327964-30327986 TTGGATCCACAGCTGCAATTTGG - Intergenic
1094487384 12:30935791-30935813 CTGGGTCCATTGGTGCAGTTAGG + Intronic
1095727377 12:45469005-45469027 CTGGGTCTGCAGCTGCTGTTTGG - Intergenic
1096602725 12:52741992-52742014 CTGGGTCTGCAGCTGCAATTTGG - Intergenic
1096646934 12:53043909-53043931 CTGGGTCCACTCCTGCAGCTGGG - Intergenic
1097076379 12:56397628-56397650 CTGGGTCTGCAGCTGCGGTTTGG + Intergenic
1097130055 12:56805094-56805116 CTGGGTTCACAGCCACAGTTTGG + Intergenic
1098335648 12:69401949-69401971 CTAGGTTCACAGCTGCATCTGGG - Intergenic
1098798314 12:74922149-74922171 CTGGGTCCTCTGGTGCCATTGGG - Intergenic
1100672906 12:96835670-96835692 CTGAGTTTACAGCTGCAGTTTGG + Intronic
1101337673 12:103810736-103810758 CTGGGTTCGCTGCTGCATTTTGG - Intronic
1101764114 12:107682684-107682706 CCAGATCCACAGCTGCAGTTTGG + Intergenic
1101764124 12:107682739-107682761 CTGGGTCTGCAGCTGCAGTTTGG + Intergenic
1104041609 12:125134529-125134551 CAGTGTCCACACCTGCAATGGGG + Intronic
1105425259 13:20289017-20289039 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1105484671 13:20815430-20815452 CTGAGTCCACAGCAAAAATTGGG - Intronic
1106004198 13:25753267-25753289 GTGGTTCCACAGCTGCCCTTTGG + Intronic
1106041144 13:26095042-26095064 CTGGGTCCACAGTTGCTTTGTGG + Intergenic
1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG + Intronic
1106477614 13:30111978-30112000 CTGGGGCCCCAGCTCCAGTTAGG - Intergenic
1106571873 13:30934755-30934777 CTGGGTCTGTAGCTGCAGTTTGG - Intronic
1107234828 13:38155568-38155590 CTGGGTCTGCAGCTGCGGTTTGG + Intergenic
1107534100 13:41311383-41311405 ATTGGTCTACAGTTGCAATTGGG - Exonic
1107875989 13:44790509-44790531 CTGGGTCTGCAGCTGCGGTTTGG + Intergenic
1108118699 13:47160182-47160204 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1108240433 13:48457942-48457964 CTGGGTCCACAGCCACGGTTTGG + Intronic
1108641258 13:52384413-52384435 CAGGGTCCTCATCTGCAATGTGG + Intronic
1109348371 13:61145098-61145120 CTGGGTCCACAGCCACAGCTGGG - Intergenic
1109426127 13:62168009-62168031 CTGGGTCCACAGCTGCAGTTTGG - Intergenic
1109525144 13:63566069-63566091 CTGGGTCCATAGCTGCAGCTTGG - Intergenic
1109982199 13:69923857-69923879 CTGGGCCCACAGCTGCAGCTTGG - Intronic
1110008075 13:70297222-70297244 TGGGATCCACAGCTGCAGTTTGG - Intergenic
1110132294 13:72022785-72022807 CTGGGTCCACACCTACACTGAGG + Intergenic
1110201041 13:72851232-72851254 CTGGGTCCGCAGCTGCGACTGGG - Intronic
1110206827 13:72924584-72924606 CTGGGACCACAGGTGCATTAGGG - Intronic
1111542782 13:89689998-89690020 ATGGGTCCAGAGATGCTATTTGG - Intergenic
1112086009 13:96033537-96033559 GTTGGTCCACAGCTGCAGCTGGG - Intronic
1113339047 13:109404413-109404435 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
1114349667 14:21836083-21836105 CTCGGTCCACAGCTGCAGTTTGG + Intergenic
1122309344 14:100784641-100784663 CTGTGTACACAGCAGCATTTGGG + Intergenic
1124937439 15:34186395-34186417 TGGGATCCACAGCTGCAGTTTGG - Intronic
1125435899 15:39645386-39645408 CTGGGTCTGTAGCTGCAGTTTGG - Intronic
1125552264 15:40554282-40554304 CAGGATGCACAGCTGCCATTAGG - Intronic
1125718006 15:41830630-41830652 CTGGGTCCACAGCTGCAGCTTGG - Intronic
1126215119 15:46145965-46145987 CTGGGTCTACAGCTGCAGCTGGG - Intergenic
1126351111 15:47745596-47745618 CTGGGTCCACAGAGGCAAAATGG - Intronic
1128847769 15:70916868-70916890 CTGGGTCCACAGCTGCAGTTTGG - Intronic
1128907904 15:71484699-71484721 CTGTTTCCACACCTGCAAATGGG - Intronic
1128965170 15:72051492-72051514 CTGGGTCTGCAGCTGCAGCTTGG - Intronic
1129264968 15:74388551-74388573 CTAGGTCCACAGGTGCATATGGG - Intergenic
1129377851 15:75145406-75145428 CTGGGTCCACAGCTGTGACTTGG + Intergenic
1129468345 15:75736852-75736874 CTGGGTACAGAGCTGCAGTGTGG - Intergenic
1129727229 15:77907648-77907670 CTGGGTACAGAGCTGCAGTGTGG + Intergenic
1130183062 15:81651324-81651346 CTGGGTCCACAGCCACAGTTTGG - Intergenic
1130227860 15:82073377-82073399 CTGGGTCTGCAGCTGCCATTTGG + Intergenic
1132199826 15:99943764-99943786 TTGGGTCCACAGCGCCAGTTGGG + Intergenic
1132305244 15:100807412-100807434 CTGGGTCCACAACTGTGGTTTGG - Intergenic
1132314827 15:100881871-100881893 CTGGGTCCACAACTGCTATGGGG - Intronic
1133409737 16:5558331-5558353 CTGCCTCCACAGCTGCATCTAGG - Intergenic
1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG + Intronic
1137291650 16:47055657-47055679 TTGGATCCACAGCCGCAGTTTGG + Intergenic
1137334446 16:47533853-47533875 CTGGGTCCACAGCCACAACTTGG + Intronic
1137334466 16:47533934-47533956 CTGGGCCCACAGCCACAACTTGG + Intronic
1137698574 16:50478995-50479017 CTGGGTCTGCAGCTGCAGTTTGG + Intergenic
1138033642 16:53580558-53580580 CCTGGTCCACAGCTGGACTTAGG + Intergenic
1138878241 16:60979232-60979254 CTGGGTCCCCAGCTGCAGTTTGG - Intergenic
1139088794 16:63618614-63618636 CTGGGTCCACAACCGCGACTGGG + Intergenic
1139183004 16:64770184-64770206 CTGGGTCCACAGCCACAACTGGG - Intergenic
1139183024 16:64770275-64770297 CTGGGTCCACAGGTGCAGTTTGG - Intergenic
1139268546 16:65661452-65661474 CTAGGTCCAGAGCTGGAGTTTGG + Intergenic
1140475844 16:75238887-75238909 CTGGGTCCCCACCTGCCTTTGGG - Intronic
1140778999 16:78276604-78276626 CTGGCTCTGCAGCTGAAATTGGG + Intronic
1141473514 16:84255591-84255613 CTGGGAACAAAGGTGCAATTTGG - Intergenic
1142750652 17:1985464-1985486 CTGGGTCCACTGCTTCACTGGGG + Intronic
1143088754 17:4436040-4436062 CTGGGTCCACAGCAGCCAGCAGG - Intronic
1143680854 17:8475075-8475097 CTGGGGCCTCAGCTGCAGTGTGG + Exonic
1144386161 17:14751083-14751105 CTGGGTCTGCAGCTGCGTTTTGG - Intergenic
1144714405 17:17424157-17424179 CTGGGTCCACAGCAGTGGTTGGG - Intergenic
1146235674 17:31159157-31159179 CTTGGTCCACATCTGTACTTTGG - Intronic
1146257635 17:31400792-31400814 CTGGCTCCACAGCTGCACTCAGG - Intronic
1148640565 17:49184151-49184173 CTGGGTCTGCAGCTACAGTTTGG + Intergenic
1149362596 17:55910978-55911000 CTGGGTCTGCAGCTGCACCTGGG + Intergenic
1150579624 17:66460521-66460543 CTGTCTGCACTGCTGCAATTCGG - Intronic
1150608967 17:66717916-66717938 CTGGGTCAACACCTGCTACTTGG - Intronic
1152120831 17:78417353-78417375 TTGGGACCTCAGCAGCAATTAGG + Intronic
1153608057 18:6854766-6854788 CCGGGTCCAGAGCTGCAGGTGGG - Intronic
1154070891 18:11149988-11150010 CTGGGTCCACAGGTGCACACTGG + Intergenic
1155120840 18:22816920-22816942 CTGGGTCTGCAGCCACAATTCGG + Intronic
1156298963 18:35818393-35818415 CCGGGTCCACAGCTGGGGTTTGG + Intergenic
1157799058 18:50603594-50603616 CTGAGTCCACAGCTGCAGAATGG + Intronic
1157933977 18:51854047-51854069 CTGAATCCACAGCTGCTATCAGG - Intergenic
1158773696 18:60552679-60552701 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
1159186595 18:64983695-64983717 TTGGATCCACAGCTGCAGTTGGG - Intergenic
1159925729 18:74267771-74267793 GTGGATCCACAGCTTCCATTTGG - Intronic
1162747351 19:12806236-12806258 CTGGGTCCCCAACTGCCACTTGG - Intronic
1163051927 19:14690591-14690613 CTGGGTCCACATGTGCAAACTGG + Intronic
1165007531 19:32818822-32818844 CTGGGTCTGCAGCTGCACCTGGG - Intronic
1165027073 19:32969809-32969831 TCGGATCCACAGCTGCAGTTTGG + Intronic
1165319577 19:35076930-35076952 CTGGAGCCACAGCTGCCATCTGG - Intergenic
1165899961 19:39164767-39164789 CTGTTTCCACAGCTGCAAAATGG + Intronic
925048092 2:789748-789770 CTGGGTCCACAGCCGTGGTTTGG - Intergenic
926647325 2:15303810-15303832 CTGGCTCCACAGCCACATTTTGG - Intronic
926859391 2:17292242-17292264 CTGGGTCTGCAGCTGCGGTTTGG + Intergenic
928723746 2:34148122-34148144 CTGGGTCCACGGCTGGGCTTGGG + Intergenic
928913602 2:36447892-36447914 CTGGGTCTTCAGGTGAAATTCGG + Intronic
929291042 2:40191828-40191850 CTGGGTCAAAAGCTGAAATAGGG - Intronic
930160524 2:48151313-48151335 CAGTGTCAACAACTGCAATTTGG - Intergenic
930230608 2:48840671-48840693 CTGGGTCCAGAGATGCCATCGGG + Intergenic
930728880 2:54709163-54709185 CTGGGTCCACAGCCACGACTTGG - Intergenic
931175194 2:59847367-59847389 CTGATTCCACAGCTGGAAATTGG - Intergenic
931300369 2:60973307-60973329 TTAGGTCCACAGCCGCAAGTTGG - Intronic
932314323 2:70769267-70769289 CTGGTTCCACAGCAGCACTGTGG - Intergenic
932644750 2:73488489-73488511 CTGGGTCTACAGCTGTGACTGGG + Intronic
932863311 2:75316667-75316689 CTGGATCCACTCCTGCAATTAGG - Intergenic
933219405 2:79670397-79670419 CTGGGTCTGCAGTTGCGATTTGG + Intronic
933801260 2:85961818-85961840 CTGGGTCAGCAGTTGCAGTTGGG + Intergenic
934699767 2:96430203-96430225 CTAGGTCCACAGGTGTAGTTTGG - Intergenic
935172328 2:100620170-100620192 CTGGTTCTTCAGCTGCAATGGGG - Intergenic
935518871 2:104078837-104078859 CTGGGTCCACAGCCGCAACTTGG + Intergenic
935674217 2:105580257-105580279 CTGGGTCCTCAGCGGCACATGGG - Intergenic
935730975 2:106065085-106065107 CTGGGTTCAGAGCTGCAGTCCGG - Intronic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
938038307 2:128054515-128054537 CTGTGTCCAGGGCTGCAATCTGG + Intergenic
938180756 2:129179642-129179664 CTGGATCCACAGCCGCAGTTTGG + Intergenic
940422929 2:153499876-153499898 CTGGGTGCACAGCTGCGGCTGGG + Intergenic
940612332 2:156006934-156006956 CTGGGTCCACAGCCCCAGCTTGG + Intergenic
941043515 2:160648643-160648665 CTGGGTCCCCAGCAGCAACTTGG - Intergenic
942915074 2:181295046-181295068 CTGGGTCCAGAGGTGCTCTTTGG - Intergenic
943226418 2:185184973-185184995 CTGGGTCCAGAGCTGCAACTGGG - Intergenic
943526174 2:189020466-189020488 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
943820473 2:192314983-192315005 TCGGGTCCACAGCCGCAAATTGG + Intergenic
943947712 2:194089650-194089672 AAGGGTCCACAGCTTCATTTTGG - Intergenic
944483717 2:200182061-200182083 CTGGGTCTACAGCTGCAGTTTGG - Intergenic
947663055 2:231884274-231884296 CTGGGCCCACAGCTTCTTTTTGG + Intergenic
948712894 2:239836295-239836317 CTGGGTCCACAGCCACAACTTGG - Intergenic
949039560 2:241841524-241841546 CAGGGTCCACAGCTCGAATTGGG - Intergenic
1170470733 20:16665412-16665434 CTGGGTCAACTGTTGGAATTCGG - Intergenic
1173510115 20:43620901-43620923 CTGGGTCCTCAGCATCAATCTGG - Exonic
1173524591 20:43721913-43721935 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1173893767 20:46534213-46534235 CTGGGTCTGCAGCGGCAAGTTGG - Intergenic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175537549 20:59725443-59725465 CTGGGTTCACAGCCTCAATAAGG - Intronic
1176095942 20:63344672-63344694 CTGGGTCCACTTATGCAATGTGG + Exonic
1177404229 21:20645409-20645431 CTGGGTCTGCAGCTGCAGCTGGG - Intergenic
1179032341 21:37731589-37731611 AAGGTTACACAGCTGCAATTGGG + Intronic
1179437574 21:41373024-41373046 CTGTCTCCCCAGCTGCAATAAGG - Intronic
1181789938 22:25257260-25257282 CTGGGTGCAGAGCTGGCATTGGG - Intergenic
1181824733 22:25505951-25505973 CTGGGTGCAGAGCTGGCATTGGG - Intergenic
1183025061 22:35058676-35058698 CTGGGTCCACAGCCGCAGTTTGG + Intergenic
1183316757 22:37141313-37141335 CTGGGTCCACAGCCACAACTTGG - Intronic
1184097547 22:42324843-42324865 CTGGGTCCTCACCTGCAAGATGG - Intronic
1184561003 22:45262920-45262942 CTGGGTCCGCAGTGGCAGTTAGG + Intergenic
1185108694 22:48888713-48888735 TTGTTTCCACAGCTGCAATCAGG - Intergenic
950240717 3:11367599-11367621 CTGGGTCCACAGGCAGAATTTGG + Intronic
950801007 3:15551856-15551878 CTGGGTCCAGAGATGCCATCCGG + Intergenic
952203065 3:31151245-31151267 CTGGGTCCAAAGGTGCCATCTGG + Intergenic
952269511 3:31817623-31817645 TTGGATCCACAGCCGCAGTTTGG + Intronic
952793237 3:37217186-37217208 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
953763219 3:45710990-45711012 CAGGGTCCACAGCTTCATTCTGG - Intronic
954651023 3:52162697-52162719 CTGGGTCTGCAGCTGCAGTTTGG + Intergenic
955949822 3:64231853-64231875 AAGGGTCCACAGCTGAAGTTTGG + Intronic
956789681 3:72670976-72670998 CTTGGTCCATAACTGCATTTGGG - Intergenic
957624377 3:82640580-82640602 CTCAGTCTGCAGCTGCAATTTGG - Intergenic
957705036 3:83770065-83770087 TGGGATCCACAGCTGCAGTTTGG - Intergenic
957794679 3:84988002-84988024 CTGTGGCCACAGCTCCAAATCGG - Intronic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960136858 3:114114222-114114244 CTGGCACCACAGCTGCAATTAGG - Intergenic
960349424 3:116574857-116574879 CTGGTACAGCAGCTGCAATTGGG - Intronic
960383686 3:116994150-116994172 CTGGCTCAGCAGCTGCAGTTGGG - Intronic
960690460 3:120341794-120341816 CTGGGTCTGCAGCTGCAGGTTGG - Intronic
961561556 3:127733863-127733885 CTGGGTGCGCAGCTGCACCTGGG + Intronic
962105343 3:132383366-132383388 CTGGGTCCACAGCTGTGGTTTGG + Intergenic
962606053 3:137033854-137033876 TTGGGTCCACACCCTCAATTAGG + Intergenic
962742334 3:138370860-138370882 CTGGATCCACACCTGGCATTAGG + Intronic
964179472 3:153865857-153865879 CTGGGTCCAGAGATGCTGTTGGG - Intergenic
964590822 3:158360824-158360846 CTGGGTCCACAGCCCCAACTTGG + Intronic
964791950 3:160460731-160460753 TCGGATCCACAGCTGCAGTTTGG + Intronic
965261236 3:166489172-166489194 CTGGGTCCACAGCCACAACTTGG - Intergenic
965442349 3:168730064-168730086 GAGGGTCCACAGCTGAGATTGGG - Intergenic
965774096 3:172210079-172210101 CTGGGTCCAGAGCTGCAGCTGGG + Intronic
968603758 4:1521951-1521973 CTGGGCTCACAGCTGCCACTCGG + Intergenic
970440602 4:16078131-16078153 CTGGAGCCACAGCTGCTTTTAGG - Intronic
972128493 4:35800945-35800967 CTAAGTCCACAGCTGCAGTTTGG - Intergenic
972358370 4:38303627-38303649 CTGGGTCCACTACTGAAATTTGG + Intergenic
972735056 4:41832352-41832374 CTGGAGCAACAGCTGTAATTGGG - Intergenic
974082741 4:57229751-57229773 CAGTGTCCACACCTGCAAATTGG + Intergenic
974432467 4:61816830-61816852 CTGGGTCCAGAGCTGCTACTAGG - Intronic
974558904 4:63491861-63491883 CTGGTACAGCAGCTGCAATTTGG - Intergenic
974683595 4:65195474-65195496 CTGGGTCTGCGGCTGCAACTTGG + Intergenic
975040965 4:69743907-69743929 CTGGGTCAACAGCTGCGCATGGG + Intronic
975201663 4:71597406-71597428 CTGGGTTTACATCTGCATTTTGG + Intergenic
975572281 4:75830159-75830181 CTTGGTGCACTGGTGCAATTTGG + Intergenic
976511189 4:85911089-85911111 CTGAGTCTGCAGCTGCAGTTTGG + Intronic
977471751 4:97452059-97452081 CTGGCTCTGCAGCTGCAGTTTGG - Intronic
979448306 4:120840069-120840091 CTGGGTCCACAGCGCCAACTTGG + Intronic
980180120 4:129392329-129392351 CTGGGTCCACAGCCGTGGTTTGG - Intergenic
980450045 4:132958822-132958844 CTAGGTCCACAGCTGCAACTTGG - Intergenic
980475570 4:133310125-133310147 GGGGTTCCACAGCAGCAATTGGG + Intergenic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
982957600 4:161792019-161792041 CTGGGTCCACAGCTGCAGCTGGG - Intronic
983491788 4:168398080-168398102 CTGGGTCCACAGTTGCAGCTTGG - Intronic
983960380 4:173745877-173745899 CTGGGCCATCAGATGCAATTTGG + Intergenic
984325086 4:178241603-178241625 CTGGGTCCACAGCTGCGGCTTGG - Intergenic
985541163 5:488411-488433 CCGGGTCCACAGCCGCCATGAGG + Exonic
986073326 5:4309193-4309215 CAGGCTCCGCAGCTGAAATTAGG + Intergenic
987816089 5:22902140-22902162 CTGGGTCCAGAGCTGCAGCTGGG + Intergenic
988346273 5:30041837-30041859 CTGGGTCCACAGCCGCGGCTGGG - Intergenic
988566019 5:32320583-32320605 CTGGGTCCGCAGCCGCAACCTGG + Intergenic
988940302 5:36139080-36139102 CTGGGTCCACAGCCACAGCTGGG - Intronic
990265677 5:54072350-54072372 GTTTATCCACAGCTGCAATTAGG - Intronic
990406506 5:55496413-55496435 CTGGGACTACAGCTGCTATCAGG + Intronic
990639001 5:57761629-57761651 CTGGGTCTGCAGCTGCGATTTGG - Intergenic
992583609 5:78208556-78208578 ATGGGTCCACATCTGGAAATTGG - Intronic
994450034 5:99929869-99929891 ATGGGTCCACAGCTGTGATTTGG + Intergenic
994790947 5:104224470-104224492 TTGGATCCATAGCTGCAGTTTGG + Intergenic
995408357 5:111827579-111827601 GGGGGTTCACACCTGCAATTTGG + Intronic
996084662 5:119292205-119292227 CTTGGGCCAGAGCTGCAATAGGG - Intronic
996530739 5:124524407-124524429 CTAGGACCACAACCGCAATTTGG + Intergenic
998792186 5:145777694-145777716 CTGGGTCTGCAGCTGCAGTTTGG - Intronic
999799577 5:155020123-155020145 CTGGGTCTGCAGCTGCAGGTTGG + Intergenic
1001280061 5:170380417-170380439 CTGGCTCAACACCTGCCATTTGG - Intronic
1001760797 5:174206517-174206539 CTGGGTCCACAGCTGCCCAACGG + Intronic
1002688909 5:181037080-181037102 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1004304360 6:14487142-14487164 CCAGGTCTACAGCTGCAACTTGG - Intergenic
1004399161 6:15272570-15272592 TTGTTTCCACAGCTGCAATTTGG - Intronic
1007649840 6:43412649-43412671 CTGGGTCCACAGCTGGGGTTGGG - Intergenic
1012122255 6:95383929-95383951 CTGGGTCCACAGCTGTGAGTTGG - Intergenic
1012749610 6:103140720-103140742 CTGGGCCTACAGCTGCAAGTGGG + Intergenic
1012752662 6:103183735-103183757 CTGACTTCACAGCTGCAACTTGG - Intergenic
1013066180 6:106686341-106686363 CTGGCCCAACAGCTGCAATCAGG - Intergenic
1013783862 6:113757737-113757759 ATGGGTACACAGTTTCAATTTGG - Intergenic
1014534305 6:122597471-122597493 CTGGTACAGCAGCTGCAATTGGG + Intronic
1015143197 6:129958424-129958446 CTAGGTCCACAGCCGCAACCTGG - Intergenic
1015455785 6:133424791-133424813 TTGGATCCACAGCCGCAGTTTGG + Intronic
1016758958 6:147716436-147716458 CTGGGTCCACAGCTGTGGCTTGG + Intronic
1016790504 6:148062541-148062563 CTTGATCCAGAGCTGCATTTAGG + Intergenic
1017054374 6:150424410-150424432 CTGGGTCTACAGCTGCAACTTGG - Intergenic
1020568177 7:9823042-9823064 CTGGGTCTGCAGCAGCGATTTGG + Intergenic
1021097151 7:16547496-16547518 CTGGGCCCACAGCAGCAGTTTGG - Intronic
1022290473 7:28997878-28997900 CTGGTCCCACATCTGCAAATGGG - Intronic
1022494822 7:30846199-30846221 CAGGGTCAAAAGCTGCAATAGGG - Intronic
1023789002 7:43737317-43737339 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1023790610 7:43750262-43750284 CTGGGTCTGCAGCTGCAGTTTGG + Intergenic
1024254662 7:47531820-47531842 TTGGATCTACAGCTGCAGTTTGG - Intronic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1026165823 7:67908429-67908451 CTGGGATCACAGCTGCAATTGGG - Intergenic
1028136659 7:87230180-87230202 CCAGGTCCACAGCTGCAGCTGGG - Intergenic
1028233189 7:88330058-88330080 CTGGGTCTGCAGCTGCAGTTTGG - Intergenic
1028816957 7:95157282-95157304 CTGGGTCTGCAGCCGCAATATGG + Intronic
1028816998 7:95157444-95157466 CCAGGTCTGCAGCTGCAATTTGG + Intronic
1029899200 7:104022035-104022057 CTGGGTCCACAGTTGTGGTTTGG - Intergenic
1029973875 7:104814957-104814979 CTGGGTCCATAGCTGCAGTTTGG + Intronic
1030243701 7:107359120-107359142 CTGGGTCCACAGCTGTGGCTGGG - Intronic
1032658423 7:133955983-133956005 CCAGGTCCACAGCTCCAGTTTGG + Intronic
1032658450 7:133956074-133956096 CTGGGTCCGCAGCTGCAACTGGG + Intronic
1034481096 7:151320918-151320940 CTGGGTCCACAGCCCCAACTTGG - Intergenic
1034567183 7:151924545-151924567 CTGGGCCCACCCCTGCGATTTGG - Intergenic
1036914913 8:12796210-12796232 CTGGGCCCACCGCTGCACTGTGG + Intergenic
1040391652 8:46955271-46955293 CCGGGTCCACTGCTCCAATGTGG - Intergenic
1040725739 8:50379375-50379397 ATGGCTTCACAGCTGCAGTTGGG + Intronic
1042196904 8:66238587-66238609 CTGGGTCCACAGCCACAGTTTGG + Intergenic
1043735114 8:83731367-83731389 CCAGGTCCACAGCCACAATTTGG + Intergenic
1044525058 8:93242058-93242080 CTGGGTCCACAGCAGCTGTTTGG + Intergenic
1046480728 8:114814044-114814066 ATGGATTCACAGCTGAAATTTGG + Intergenic
1048548061 8:135405194-135405216 CTGGGTCTGCAGCTGCAGCTAGG + Intergenic
1048888508 8:138928183-138928205 CTGTGTCCATAGCAGCAACTTGG + Intergenic
1049334373 8:142075016-142075038 CTGGGTTCCCAGCTGCACGTGGG - Intergenic
1050627953 9:7526020-7526042 CTGAGTACAAATCTGCAATTTGG + Intergenic
1052610123 9:30760606-30760628 ATGGATCCACAACTGAAATTTGG + Intergenic
1052707461 9:32010693-32010715 CTGGGTCTCCAGCTGCGGTTTGG - Intergenic
1053076481 9:35138793-35138815 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1053617261 9:39781322-39781344 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053619240 9:39798993-39799015 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053875444 9:42540685-42540707 TTGGATCCACAGCTGCAGTTTGG - Intergenic
1053877396 9:42558342-42558364 CTGGGTCCACAGCTGCAGCTTGG + Intergenic
1053897201 9:42753948-42753970 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054234299 9:62543380-62543402 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054236256 9:62561039-62561061 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054264917 9:62908436-62908458 CTGGGTCCACAGCTGCAGCTTGG - Intergenic
1054266905 9:62926115-62926137 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054550398 9:66595569-66595591 TTGGATCCACAGCTGCAGTTTGG + Intergenic
1054716188 9:68559851-68559873 CTGGGCCCCTAGCTTCAATTTGG - Intergenic
1055572520 9:77631958-77631980 CTGGGTCTGCAGCTGCAGTTTGG - Intronic
1055645324 9:78357242-78357264 CTGGGTCCACAGCCGCGACTTGG - Intergenic
1057510928 9:95678897-95678919 CTGGGTCCACAGCCTGACTTGGG + Intergenic
1058270751 9:102968406-102968428 CTGGGTCTGCAGCTGCAACTGGG + Intergenic
1058774328 9:108268934-108268956 CGGGGAACAGAGCTGCAATTAGG - Intergenic
1059565401 9:115379529-115379551 CTGAGTCTGCAGCTGCAGTTTGG - Intronic
1060618731 9:125043939-125043961 ATGGGTCCAAAGCTGCAGCTGGG - Intronic
1185669162 X:1792173-1792195 ATGGGTCCACAACTGGGATTTGG - Intergenic
1185935887 X:4257024-4257046 TCAGGTCCACAGCTGCAACTAGG - Intergenic
1186462477 X:9759415-9759437 CTGGATCCACATCTGCAATCGGG + Exonic
1186805758 X:13139130-13139152 CTGGGTCTAAAGCTGCAGTTTGG - Intergenic
1188207678 X:27380440-27380462 CTGGGTCCACAGCCACAGCTTGG - Intergenic
1188451647 X:30313491-30313513 GTTTGTCCACAACTGCAATTTGG + Intergenic
1188756404 X:33968989-33969011 CTGGGTCCTCAGTTGCAACTTGG - Intergenic
1189083494 X:37997400-37997422 CTGGGTCTGCAGCCGCGATTTGG - Intronic
1189360040 X:40343406-40343428 CTGGGTCTGCAGCTGCGGTTTGG - Intergenic
1189360061 X:40343483-40343505 TCGGATCCACAGCTGCAGTTTGG - Intergenic
1190483528 X:50901253-50901275 TTGGGTCCACAGTTACAAATAGG - Intergenic
1190681592 X:52831016-52831038 CTGGGTCTACAGCTGCTGTTTGG - Intergenic
1190998676 X:55637056-55637078 CTGGGTCTTCAACTGCAGTTTGG - Intergenic
1191093698 X:56652590-56652612 CTTGATCCACAGCTGCATTTAGG + Intergenic
1191109494 X:56793758-56793780 CTGGCTCCACAGCTGTCTTTAGG + Intergenic
1191221107 X:57989495-57989517 TTGGATCTACAGCTGCAAATGGG - Intergenic
1192120691 X:68452640-68452662 CTAGGACCACAGATGCACTTAGG - Intergenic
1193554052 X:82932134-82932156 CTGGGTTCACAGCTGTGACTTGG - Intergenic
1194205188 X:91003177-91003199 TTGGATCCATAGCTGCAGTTTGG + Intergenic
1194205209 X:91003252-91003274 CTGGGTCTGCAGCTGCCTTTCGG + Intergenic
1197609669 X:128623762-128623784 CTGGGTCCACAGCCACAACTTGG + Intergenic
1197951969 X:131907906-131907928 CTGGGTCTGCAGCTGCGGTTTGG - Intergenic
1198699582 X:139382600-139382622 TCGGATCCACAGCTGCATTTTGG + Intergenic
1200551007 Y:4578298-4578320 TTGGATCCATAGCTGCAGTTTGG + Intergenic
1201067047 Y:10106890-10106912 TTGGGTCCACAGATGCTACTTGG - Intergenic
1201762487 Y:17555320-17555342 CTGGGTCCAGAAGTGCCATTCGG - Intergenic
1201839065 Y:18350668-18350690 CTGGGTCCAGAAGTGCCATTCGG + Intergenic
1201981635 Y:19915787-19915809 TTGCCTCCTCAGCTGCAATTAGG - Intergenic
1202113021 Y:21444361-21444383 CTGGGTCCACAGTGGCACTGTGG - Intergenic