ID: 1134079856

View in Genome Browser
Species Human (GRCh38)
Location 16:11317206-11317228
Sequence CAGGAGACACAGCTGGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 848
Summary {0: 1, 1: 0, 2: 7, 3: 81, 4: 759}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134079849_1134079856 28 Left 1134079849 16:11317155-11317177 CCATTTTATAGATAAGCAAACTG 0: 2
1: 118
2: 1194
3: 4932
4: 12176
Right 1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG 0: 1
1: 0
2: 7
3: 81
4: 759

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134079856 Original CRISPR CAGGAGACACAGCTGGAAGG AGG Intronic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
901428899 1:9200394-9200416 CAAGAGACAGGGCTGCAAGGAGG + Intergenic
901775457 1:11557460-11557482 AAGGACACACAGCTGGCAGGTGG - Intergenic
902077802 1:13801535-13801557 AAGAACACACAGCTGGCAGGCGG - Intronic
902189871 1:14754828-14754850 AAGGTCACACAGCTGGCAGGTGG - Intronic
902203950 1:14853681-14853703 CAAGAGACACAGCTGGAGCCTGG - Intronic
902376498 1:16032432-16032454 CTGGAGACACTGCTGGGAGTGGG - Exonic
902478223 1:16699158-16699180 CAGGCCACACAGCTAGAGGGTGG + Intergenic
902930293 1:19726334-19726356 CCAGAGTCAGAGCTGGAAGGTGG - Intronic
902939688 1:19791760-19791782 CAGGAGTCACTGACGGAAGGAGG + Intronic
903295056 1:22338484-22338506 CAGGGGACAGAGCTGAATGGGGG + Intergenic
903347371 1:22695265-22695287 AAGGGCACACAGCTGGGAGGTGG - Intergenic
903464890 1:23545219-23545241 CTGGAGCCACAGCTGCAAGGTGG + Intergenic
903592220 1:24465692-24465714 GAGGTCACACAGCAGGAAGGTGG - Intronic
903744446 1:25577279-25577301 GAGCAGACCCAGCTGGGAGGTGG + Intergenic
904222518 1:28984135-28984157 GAGGAGAAACAGCTGGATGTTGG - Intronic
905269866 1:36780813-36780835 AAGGACACACAGCCAGAAGGTGG + Intergenic
905271864 1:36792653-36792675 CAGCAGAGAGAGCTGGATGGTGG - Intergenic
905321967 1:37124218-37124240 AAGGACACACAGCTGGTAAGTGG + Intergenic
905812461 1:40922756-40922778 AAGGACACACGGCTGGGAGGAGG - Intergenic
905936815 1:41830837-41830859 CAGGAGTAAGAGCTGGGAGGTGG + Intronic
906067631 1:42993517-42993539 CAAGTGACGCAGCTGGAAAGGGG - Intergenic
906137714 1:43511396-43511418 TAGGACAAACAGATGGAAGGTGG - Intergenic
906141486 1:43536428-43536450 CAGAAGCCACACCTGGAAAGAGG - Intronic
906294801 1:44643016-44643038 CAGGAGACAGAGCTGTAACTTGG + Intronic
906543146 1:46603570-46603592 CAGGACACACAGCTAAGAGGTGG + Intronic
906801560 1:48742093-48742115 CTGCATACACAGCTTGAAGGAGG + Intronic
907048550 1:51314761-51314783 CAGGTCACACAGCTGGTAGCTGG - Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907915935 1:58870102-58870124 AAGAAGACAAAGCTGGCAGGTGG - Intergenic
908170685 1:61501586-61501608 AAGGAGAGACAGCTGGAAGGTGG + Intergenic
908231846 1:62112923-62112945 CAGGTTACACAGCTAGCAGGTGG - Intronic
908595895 1:65688407-65688429 CTGCAGACACAGCAGGCAGGCGG + Intergenic
910578572 1:88795658-88795680 CAGGCCACACAGCTAGAAAGTGG + Intronic
910798862 1:91125268-91125290 CAGAAGAGAAAGCTGGAAGACGG - Intergenic
911506364 1:98757399-98757421 CTGAGGACACAGCAGGAAGGTGG - Intronic
911793047 1:102042726-102042748 CAGGAGACATGGCTGGATGGTGG - Intergenic
912483302 1:110002384-110002406 CAGAAGAGCCAGCTTGAAGGAGG + Intronic
912688922 1:111789055-111789077 CAGATGACACAACTGAAAGGGGG + Intronic
913024959 1:114828940-114828962 CAGGAGACTGAGCTGGGAGGAGG - Intergenic
913279963 1:117176266-117176288 AAGCTGTCACAGCTGGAAGGTGG + Intronic
913333529 1:117686692-117686714 CACAAGTCACAGCTGGCAGGTGG + Intergenic
913380688 1:118207330-118207352 CAGTAGACAAAGATGGAAAGAGG + Intergenic
914012694 1:143791839-143791861 CGGGAGCCACTGCTGAAAGGCGG - Intergenic
914165136 1:145169345-145169367 CGGGAGCCACTGCTGAAAGGCGG + Intergenic
914247332 1:145896027-145896049 CATGGGCCACAGCTGGAAGGAGG + Exonic
914651319 1:149700448-149700470 CGGGAGCCACTGCTGAAAGGCGG - Intergenic
914663209 1:149810896-149810918 CAGGAGAAGCACCTGGAAGCAGG + Intronic
914946206 1:152068842-152068864 GAGGAGAAACAGGTGGAATGGGG - Intergenic
915473835 1:156140943-156140965 CAGGCCACTCAGCTCGAAGGTGG + Intergenic
915591893 1:156875492-156875514 GAGGAGACACAGCCGCATGGAGG - Intronic
915732891 1:158066771-158066793 CAAAAGACAGAGCGGGAAGGAGG - Intronic
916039618 1:160950955-160950977 CAGGAGGGAGGGCTGGAAGGTGG - Intronic
916204418 1:162301361-162301383 GGGAAGACACAGCTAGAAGGTGG + Intronic
916508895 1:165453896-165453918 CATCAGACTCACCTGGAAGGTGG + Intergenic
916762475 1:167829823-167829845 AAAGACACACAGCTGGAATGTGG + Intronic
917469531 1:175314548-175314570 CAGGAGACGAGACTGGAAGGAGG + Intergenic
917539003 1:175895518-175895540 CAGGAGTTACAGATGGAAGCAGG + Intergenic
917747152 1:178021363-178021385 CAGGAGCCACAGCAGGGATGTGG - Intergenic
918454021 1:184688506-184688528 CAGGAACCACAGAAGGAAGGTGG + Intergenic
918502431 1:185212351-185212373 CAGGAAAAACAGATGGAAGATGG - Intronic
919058822 1:192605727-192605749 AAAGAGAGACAGATGGAAGGAGG + Intergenic
919767239 1:201135321-201135343 CAAGACTCAGAGCTGGAAGGCGG + Exonic
919826950 1:201509849-201509871 CAGCAGACAAAGTTGGAAGCTGG - Intergenic
920001596 1:202803874-202803896 CAGGAGAAAAACCTGGTAGGAGG - Intronic
920414995 1:205793211-205793233 CAGGACACACAGCTGGGAGGAGG + Intronic
920904684 1:210151076-210151098 CAGAAGACTCAGGGGGAAGGAGG + Intronic
922193699 1:223341481-223341503 CAGCCTTCACAGCTGGAAGGTGG - Intronic
922240052 1:223749518-223749540 CAGGCCACACAGCTGGTAAGAGG - Intronic
922599723 1:226840676-226840698 CAGGAGGCTGAGCTGGGAGGTGG + Intergenic
923669899 1:236031527-236031549 GAGGAAACACTGCTGGAAGCAGG - Intronic
924032029 1:239895329-239895351 CTGCAGAGGCAGCTGGAAGGAGG - Intronic
924798344 1:247309191-247309213 CTGGCGACACAGCCTGAAGGAGG + Intronic
1063189753 10:3682274-3682296 CAGGTCACACAGCAGGCAGGCGG + Intergenic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1063216440 10:3930049-3930071 CTGGAGGCTGAGCTGGAAGGGGG + Intergenic
1063470319 10:6279551-6279573 CAGCAAACACAGCAGGAAGCAGG - Intergenic
1064014248 10:11760484-11760506 ATGGAGTCAGAGCTGGAAGGAGG - Intronic
1064212694 10:13373845-13373867 GAGGTCACACAGCTGGATGGAGG + Intergenic
1064492170 10:15870564-15870586 CAGGAGGCAAAGGTGGAGGGTGG + Intergenic
1064775540 10:18772922-18772944 CAGGAAAGACAACTGCAAGGTGG + Intergenic
1065010522 10:21416701-21416723 CAGGAGGCTGAGGTGGAAGGAGG + Intergenic
1065165488 10:22972541-22972563 CAGGAGACACAACTTGAAACTGG - Intronic
1065480972 10:26193537-26193559 CAGCAGAGAAAGCTGCAAGGAGG - Intronic
1066652910 10:37676355-37676377 CAAGAGAAACAGCAGGAATGAGG - Intergenic
1068905412 10:62316774-62316796 CAGGAGACAAAGGAGGATGGGGG - Intergenic
1069129692 10:64683333-64683355 CAGGAGAATCACCTGGGAGGTGG - Intergenic
1069948076 10:72001025-72001047 CAGATGAGACAGCTGGGAGGTGG + Intronic
1069984673 10:72275001-72275023 CACGAGGGTCAGCTGGAAGGTGG - Exonic
1070043684 10:72808691-72808713 CAGGAAACATGGCTGGGAGGCGG + Intronic
1070183191 10:74034334-74034356 CAGGAAACATAGCTGGAAAATGG - Intronic
1070268759 10:74931307-74931329 CAGTAGACACGGGTGGAAAGGGG - Intronic
1071981947 10:91012351-91012373 CAGGACAGACAGATTGAAGGAGG - Intergenic
1073596901 10:104809705-104809727 CATGAGTAAGAGCTGGAAGGTGG - Intronic
1074390529 10:113053885-113053907 AAGGTCACACAGCTGGGAGGCGG + Intronic
1074776184 10:116769922-116769944 GAGCATACCCAGCTGGAAGGCGG - Intergenic
1075153563 10:119956036-119956058 CAGGTGACACTTCTGGAAGCTGG + Intergenic
1075252945 10:120898585-120898607 CAGGGGAGGCAGCTGGTAGGGGG + Intronic
1075257796 10:120939263-120939285 CAGGACACAGGGCTGGAACGTGG + Intergenic
1076305560 10:129463518-129463540 CAGGAGAGAGGGCGGGAAGGAGG - Intergenic
1076638501 10:131899058-131899080 CAGAAGGCACAGCTGGGTGGGGG - Intergenic
1076739733 10:132477360-132477382 CAGGGGCCAGAGCTGGCAGGAGG - Intergenic
1077015237 11:396373-396395 GAGGAGGCACAGCTGGGGGGTGG + Intronic
1077087938 11:763953-763975 CAGGAGCCACAGCTGGGCAGTGG - Intronic
1078110659 11:8389203-8389225 CAGGGGACACAGCTGTAAGAGGG + Intergenic
1078196426 11:9140628-9140650 TAGGAAACACAGTTGAAAGGAGG - Intronic
1078393530 11:10957059-10957081 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1078779436 11:14423036-14423058 GAGGAGAGAGAGCTGGAGGGAGG - Intergenic
1079202019 11:18384506-18384528 CAGGCCACACAGCGGGAAAGTGG - Intergenic
1079301744 11:19284604-19284626 CAGGAGACAGTGCTGGAAACTGG + Intergenic
1079348901 11:19676300-19676322 ACAGACACACAGCTGGAAGGTGG - Intronic
1079581614 11:22071490-22071512 CAGGAGACATGGCTGGCTGGGGG + Intergenic
1079626643 11:22624994-22625016 CAGGAGACAGCGCTGGGTGGCGG + Exonic
1080393852 11:31872024-31872046 CAGGTGACACAGCTTAAAGAAGG + Intronic
1080780052 11:35420707-35420729 CAGGTTACTCAGCTAGAAGGTGG - Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1081325079 11:41734688-41734710 CAGGAAGCACAGCTGGAATGGGG + Intergenic
1081533107 11:43977816-43977838 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1081672096 11:44948192-44948214 CAGGAGAGGCAGCTGCAGGGCGG - Intronic
1081685789 11:45042118-45042140 CAGGGCACACAGCTAGAATGTGG + Intergenic
1081810547 11:45911669-45911691 AAGGCTACACATCTGGAAGGCGG + Intronic
1082095808 11:48128273-48128295 CAGGTATCACAGCTGGAAAGTGG + Intronic
1082814800 11:57500844-57500866 ACGGAGACAGAGCTGGAAAGGGG + Exonic
1083544565 11:63538745-63538767 GAGAACACTCAGCTGGAAGGAGG - Intronic
1083840138 11:65299558-65299580 CAGAAGGCAGAGCTGGATGGAGG - Intronic
1084096586 11:66915443-66915465 CTGGAGACACAGCAGGGAGAAGG - Intronic
1084407031 11:68980061-68980083 GAGGAGCCCGAGCTGGAAGGTGG - Exonic
1084515800 11:69637480-69637502 CAGGAGAGAAAGCTGGCTGGGGG - Intergenic
1086280401 11:85179956-85179978 AAGGACACACAGCTAGTAGGTGG + Intronic
1086863711 11:91954579-91954601 CATGACACACACCTGAAAGGTGG + Intergenic
1088728592 11:112660766-112660788 AAGCACACACAGCTGGAAGTTGG + Intergenic
1088740799 11:112765365-112765387 CAGGAGACACATCTCCAAGGTGG + Intergenic
1088796067 11:113267783-113267805 CATCAGACCCAGCTGGAGGGCGG - Intronic
1088987521 11:114922895-114922917 CAGGAAACAAAGATGGAAAGTGG + Intergenic
1089307701 11:117537030-117537052 AAGGTCACACAGCTAGAAGGTGG + Intronic
1089677032 11:120097034-120097056 GTGGAGACAGAGCGGGAAGGTGG + Intergenic
1089688860 11:120173589-120173611 CAGGAGCCACATCAGGACGGTGG + Intronic
1089693077 11:120198665-120198687 CAGGAGACAGAGCAGTAGGGTGG + Intergenic
1089812115 11:121140757-121140779 CAGAAGACACAGAGGGAAAGAGG - Intronic
1090399694 11:126441144-126441166 CCTGAGACACAGGTGGGAGGAGG - Intronic
1090404585 11:126469151-126469173 GAGGTCACGCAGCTGGAAGGTGG + Intronic
1091061864 11:132471198-132471220 CAAAAAACACAGCTGGGAGGAGG + Intronic
1091432589 12:449149-449171 GAAGAGATAGAGCTGGAAGGAGG + Intergenic
1092069265 12:5619519-5619541 CTGGATACACAGCTAGATGGGGG + Intronic
1092116755 12:6014378-6014400 CAGGGGACAAAGGTGGAAGCTGG + Intronic
1092465673 12:8729473-8729495 CAGGAGAAGCAGCTGGACGTCGG - Intronic
1093227912 12:16507698-16507720 CAGGAGACAGAGAGAGAAGGGGG + Intronic
1094648258 12:32348932-32348954 CAGCACACACAGGTAGAAGGTGG - Intronic
1095934080 12:47657931-47657953 CAGGAGAGACGGCTAGAATGGGG + Intergenic
1096226799 12:49871237-49871259 AAGGTTACACAGCTGGAAAGTGG + Intronic
1096573013 12:52534669-52534691 CAGGTGACGCAGCCAGAAGGTGG - Intergenic
1096843663 12:54393546-54393568 CAGGAGAGGCAGCTGGCAGGCGG - Intergenic
1096904735 12:54925007-54925029 AAGGTGAGACAACTGGAAGGCGG + Intergenic
1097629493 12:62042767-62042789 CAGGCGACCCCGCTGGAATGAGG - Intronic
1098179612 12:67832259-67832281 CAGGAGAGGCAGATGGAAGATGG + Intergenic
1098206235 12:68113385-68113407 CAGAACACACAGCTGGTTGGTGG + Intergenic
1101022248 12:100565144-100565166 CAGGAGCAACAGAAGGAAGGTGG + Intergenic
1101022317 12:100565871-100565893 CAGGAGACAAAACCGGTAGGAGG - Intergenic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1101286019 12:103313497-103313519 CAGGTAACACAGCTGGGAAGGGG - Intronic
1101842620 12:108339332-108339354 CCAGAGAAACAGCTGGAGGGAGG + Intronic
1102066828 12:109984047-109984069 CAGGCCACACAGCTTGAAGTGGG - Intronic
1102229898 12:111255422-111255444 CAGCAGACACACCTGGAGGCAGG + Intronic
1102440892 12:112963290-112963312 CTGGGGGCACAGCAGGAAGGTGG - Intronic
1102449186 12:113027910-113027932 CAGGAGACAGAGAGTGAAGGGGG - Intergenic
1102612303 12:114123035-114123057 CAGGGGTCACAGCTGGAAGAGGG + Intergenic
1102934775 12:116887236-116887258 CAGGAAACACAGCTGTTTGGAGG - Intergenic
1103363693 12:120368425-120368447 CAGGAGGCTCAGCGGGAACGGGG - Intronic
1103900471 12:124301205-124301227 GAGCAGACGCGGCTGGAAGGAGG - Intronic
1103988515 12:124783004-124783026 CAGGAAACACACCTGGGAGGTGG + Intronic
1104082555 12:125443221-125443243 CAGGAGACCCAGGTGTGAGGTGG + Intronic
1105212699 13:18266757-18266779 GAGGTCACACAGCTGGGAGGTGG - Intergenic
1106088845 13:26568249-26568271 CAGGGGACAAAGGTAGAAGGTGG + Intronic
1106218229 13:27721953-27721975 CAGGAGAGACAGCTGGGATGTGG + Intergenic
1106431385 13:29683823-29683845 CATGAGGCACAGCAAGAAGGTGG - Intergenic
1106691144 13:32118010-32118032 CAAAATACTCAGCTGGAAGGAGG - Intronic
1106962150 13:35011089-35011111 CAGAGGACATAGGTGGAAGGTGG + Intronic
1108116356 13:47132830-47132852 CTCAAGTCACAGCTGGAAGGTGG + Intergenic
1108277406 13:48825502-48825524 CAGGAGACAGAGAGTGAAGGGGG + Intergenic
1110686749 13:78384522-78384544 AAGGTTACACAGCTGGTAGGTGG + Intergenic
1111657449 13:91171545-91171567 CAGGAGAGAAAGCATGAAGGAGG + Intergenic
1111983238 13:95038961-95038983 AAGGAGACACAGCAGGAATGAGG + Intronic
1112109242 13:96276251-96276273 CAGAAGACAGGGCTGGAGGGAGG - Intronic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1113782301 13:112983614-112983636 CAGGGGACAGAGCTGTAAAGAGG - Intronic
1115441616 14:33442329-33442351 CAGGAGACTGAGGTGGGAGGAGG + Intronic
1117349056 14:54862841-54862863 AAGGAAACAAATCTGGAAGGTGG + Intronic
1117372442 14:55090874-55090896 GAGGAGACACAGAGGGTAGGTGG + Intergenic
1117433810 14:55697454-55697476 CTGGAGAGGAAGCTGGAAGGCGG - Intronic
1118065822 14:62189187-62189209 GAGAAGACACAGCAAGAAGGCGG - Intergenic
1118215461 14:63803993-63804015 CAGGAGACAGAGAGTGAAGGGGG - Intergenic
1118974287 14:70663953-70663975 AAGGTCACCCAGCTGGAAGGGGG - Intronic
1119167341 14:72505695-72505717 AAGGTCACACAGCTGGTAGGTGG - Intronic
1119417472 14:74482869-74482891 CAGGAGCCGCAGCTGGGAGGAGG + Intronic
1119483699 14:74975110-74975132 CAGGAGACACTGCCGGGAAGAGG - Intergenic
1119874881 14:78050277-78050299 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1120441865 14:84551592-84551614 CAGGAGAGAGAGTTGAAAGGGGG - Intergenic
1120529234 14:85611971-85611993 GAGGCAACACAGCTGAAAGGTGG - Intronic
1120863424 14:89275283-89275305 CAGCAGACACAGCTGGCTGAAGG + Intronic
1121051286 14:90820483-90820505 AAGGAGACACTGGTGGGAGGAGG + Intergenic
1121271236 14:92639497-92639519 CGGGAGACATGGCTGGAAAGGGG + Intronic
1121442687 14:93958701-93958723 AAGGAGAGACAGCCGGCAGGTGG + Intronic
1121864843 14:97353209-97353231 CAGGGGACTCCGGTGGAAGGAGG - Intergenic
1121919093 14:97863982-97864004 CAGTTGCCACAGCTGGAAGTTGG + Intergenic
1122397224 14:101442009-101442031 CAGGAGACGCAGGTGGCGGGGGG - Intergenic
1122849592 14:104520500-104520522 CAGGGACCACAGCTGGGAGGTGG - Intronic
1122888117 14:104719541-104719563 CAGGGCACACACCTGGCAGGGGG - Exonic
1124306040 15:28579955-28579977 CAGGAGGCACAGCTTGCAGTGGG - Intergenic
1124661713 15:31555138-31555160 CAGGATGGACAGCTGGATGGTGG + Intronic
1125183768 15:36907598-36907620 CAGAGGACACATTTGGAAGGTGG + Intronic
1125585462 15:40816165-40816187 CAGAAGACTCAGCTGGAGGTAGG - Exonic
1125605929 15:40939885-40939907 CAGGAGACAGGGCAGGAGGGAGG + Intergenic
1126282099 15:46965404-46965426 CAGGAGACAGAGAGTGAAGGGGG - Intergenic
1126378745 15:48023832-48023854 CAGGAGCCACAACTGGAGGCAGG + Intergenic
1126534700 15:49748869-49748891 AAGTAGAGACAGCTGGAAAGTGG + Intergenic
1126665745 15:51075142-51075164 CAGGACCCACACCTGGAAGGAGG + Intronic
1127009541 15:54607734-54607756 CAGGAGAGACAAAGGGAAGGGGG + Intronic
1127161153 15:56187721-56187743 AAAAAGAAACAGCTGGAAGGTGG + Intronic
1127698401 15:61473774-61473796 CAGGAGAGAAAGAAGGAAGGAGG + Intergenic
1127702573 15:61515226-61515248 GAGAATACACAGCTGGATGGTGG + Intergenic
1127978632 15:64017611-64017633 CTGGAGACACAGCTAGGAAGAGG - Intronic
1128310562 15:66629561-66629583 AAGGATACACAGCTAGAATGAGG + Intronic
1128498230 15:68210326-68210348 CTGGAGCCCCAGCAGGAAGGGGG - Intronic
1128532972 15:68467535-68467557 CAGGAGCCACAGCTGAAAAAAGG - Intergenic
1128559980 15:68658372-68658394 AAGGAGGCACAGATGGCAGGCGG - Intronic
1128690709 15:69722845-69722867 GAGGACACACAGCTGGAAAGGGG - Intergenic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1129224150 15:74156684-74156706 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
1129362585 15:75033679-75033701 CAGGACACAGAGCGGGCAGGTGG - Intronic
1129480445 15:75821033-75821055 AAGGCCACACAGCTGGAGGGTGG + Intergenic
1129596451 15:76967954-76967976 CAAGAGACACAGCTGTAACCTGG + Intergenic
1129607468 15:77031823-77031845 CAGGAAACACAGCAGGCAAGGGG - Intronic
1129672483 15:77614945-77614967 CAGGAGATCCAGCTGGTGGGCGG - Exonic
1129693540 15:77727834-77727856 AAGGTCACACAGCTGGCAGGTGG + Intronic
1129693673 15:77728443-77728465 CAGGGGCCACACCTGGAAGGGGG + Intronic
1130297382 15:82656813-82656835 CAGCACACACAGGTGGAAGCAGG - Intergenic
1130580479 15:85133421-85133443 CAAGGGACACAGCTGGAAACTGG + Intronic
1131101303 15:89691980-89692002 CTGGAAACACAGCTGGAATATGG + Intronic
1131653146 15:94423988-94424010 CTGGGGACAAAGCAGGAAGGAGG - Intronic
1131770904 15:95736392-95736414 CAGGAGACAGAGAGTGAAGGGGG + Intergenic
1132186196 15:99803989-99804011 AAGGTCACACAGCTGGAGGGTGG + Intergenic
1132338881 15:101065737-101065759 CCGGGCACACAGCTGGTAGGTGG - Exonic
1132429477 15:101748714-101748736 AAGGTCACACAGCTGGAGGGTGG - Intergenic
1132942798 16:2516530-2516552 CTGGGGACACAGCTGGAGGTTGG - Intronic
1133114624 16:3570066-3570088 AAGGATACACAGCTGGGAAGTGG + Intronic
1133242243 16:4421830-4421852 AAGGACACACAGCTGGTAAGTGG + Intronic
1133505101 16:6403919-6403941 GAAGAGACACAGTAGGAAGGTGG + Intronic
1133703034 16:8326693-8326715 TAGTAGACACAGGTGGCAGGAGG - Intergenic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1134079856 16:11317206-11317228 CAGGAGACACAGCTGGAAGGAGG + Intronic
1134805238 16:17118664-17118686 CAGGTGGCACAAGTGGAAGGAGG - Intronic
1134819536 16:17235465-17235487 AAGGTCACACAGCTGGAAAGAGG + Intronic
1135890906 16:26356351-26356373 GAGAAGACACAGCAGGAAGGTGG - Intergenic
1135943878 16:26846857-26846879 GAGGTTGCACAGCTGGAAGGAGG + Intergenic
1136612756 16:31377211-31377233 CGGGAGCTCCAGCTGGAAGGTGG - Exonic
1136619479 16:31418510-31418532 CGGGAGCTCCAGCTGGAAGGTGG - Exonic
1137243035 16:46674897-46674919 CAGGAGGCTGAGGTGGAAGGAGG - Intronic
1137442862 16:48511081-48511103 CAGGAAACAAAGCAGGATGGTGG - Intergenic
1137552798 16:49452200-49452222 CAGAAATCACAGCTGGTAGGTGG + Intergenic
1137621944 16:49882020-49882042 CAGGCCACACAGCTGGCAGGTGG + Intergenic
1137669712 16:50272056-50272078 CAGGAAACACAACTGGAAACGGG - Intronic
1137788995 16:51158655-51158677 CAGGTCACACTGCTGGTAGGAGG - Intergenic
1138131310 16:54482392-54482414 CAAGAGACAGAATTGGAAGGGGG + Intergenic
1138203396 16:55106623-55106645 GTGGAGACACAGCGAGAAGGTGG + Intergenic
1138338886 16:56275218-56275240 CAGGAGAGAAAGCTAGAAGGAGG - Intronic
1138418702 16:56885913-56885935 CAGGTCACACAGCTGGCAAGTGG + Intronic
1138547146 16:57726728-57726750 GAGGTCACACAGCTGGAAAGTGG + Intronic
1138618055 16:58187827-58187849 CAGGAATCAAAGCTGGAAGCTGG + Intronic
1138657325 16:58499017-58499039 CAGGAGCCACAGAGAGAAGGGGG - Intronic
1138752595 16:59441922-59441944 AAGGACACACAGCTGGTATGTGG + Intergenic
1139339525 16:66259014-66259036 CAGGTCACACAGCTGGGAAGTGG + Intergenic
1139736315 16:68991859-68991881 CCGGAGAGAAAGCTGGGAGGTGG + Intronic
1140650828 16:77086289-77086311 CAGGAGACAGAGTTGAAAGCTGG - Intergenic
1141419065 16:83899804-83899826 AAGGGGACACAGTTGGCAGGCGG - Intronic
1141710585 16:85696697-85696719 CAGGAGACTCACCTGGAGGCAGG + Intronic
1141746520 16:85929962-85929984 AAGGAGACAGAGCAGGAACGAGG - Intergenic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1141896988 16:86964580-86964602 CAGGCCACACAGCTGGTAAGTGG - Intergenic
1142026676 16:87818136-87818158 CAGCGGACACAGCTGGAGAGCGG + Intergenic
1142273693 16:89104601-89104623 CAGGAGAAGCAGAGGGAAGGTGG - Intronic
1142749991 17:1981629-1981651 GAGCAGGCTCAGCTGGAAGGAGG - Intronic
1143010164 17:3861852-3861874 CAGGAGACCAAGATGGCAGGTGG - Intronic
1143309668 17:5977988-5978010 CAAGGCACACAGCTGGACGGTGG + Intronic
1143447177 17:7016546-7016568 TGGGTGACTCAGCTGGAAGGGGG - Exonic
1143682983 17:8491441-8491463 TAGGAGACCCAGCAGAAAGGTGG + Intronic
1143722297 17:8821618-8821640 GCTGAGACATAGCTGGAAGGTGG - Intronic
1144749958 17:17641745-17641767 AATGTCACACAGCTGGAAGGTGG + Intergenic
1144794115 17:17879533-17879555 CCGGGGACACAGCGGCAAGGCGG - Intronic
1144969180 17:19096467-19096489 CAGGTCACACAGCTGGAAAGTGG + Intronic
1144978736 17:19155599-19155621 CAGGTCACACAGCTGGAAAGTGG - Intronic
1144989486 17:19222633-19222655 CAGGTCACACAGCTGGAAAGTGG + Intronic
1146376808 17:32300124-32300146 AAGAAGACACAGCTAGAAAGTGG + Intronic
1146488665 17:33263997-33264019 AAGGTCACACAGCTGGCAGGAGG - Intronic
1146650774 17:34604937-34604959 AAGGTCACACAGCTGGAAAGAGG + Intronic
1146680631 17:34805217-34805239 CAGTCCACACAGCAGGAAGGAGG - Intergenic
1147466889 17:40617263-40617285 CCGGGGAGAGAGCTGGAAGGAGG + Intergenic
1147906311 17:43825428-43825450 AAGGTTGCACAGCTGGAAGGAGG + Intronic
1148326075 17:46784188-46784210 CATGAGAAACAGGAGGAAGGAGG + Intronic
1148682311 17:49481587-49481609 CAGGAGAGACTGCGGGCAGGGGG - Intergenic
1148983462 17:51599602-51599624 CAGGACACACTGGTGGAAGGGGG - Intergenic
1150624716 17:66834576-66834598 GAGGACACACAGCTGGAAAATGG - Intergenic
1150708956 17:67513643-67513665 AAGAAGAGACGGCTGGAAGGGGG + Intronic
1150824093 17:68459244-68459266 CATTTGACAGAGCTGGAAGGTGG - Intergenic
1151411288 17:73931811-73931833 TAGGCCACACAGCTGGAAAGGGG - Intergenic
1151567114 17:74904873-74904895 AAGGCCACACAGCTGGAAAGGGG + Intergenic
1151679770 17:75617111-75617133 GAGGAGCCACAGCTGGCGGGGGG - Intergenic
1152002451 17:77655213-77655235 GAGGAGCCACAGCGGGGAGGCGG + Intergenic
1152254709 17:79231123-79231145 GAGGAGACAGAGCTGAGAGGTGG + Intronic
1152374989 17:79914360-79914382 GAGGTCACACAGCTGGAAAGGGG + Intergenic
1152513404 17:80805494-80805516 CAGGAGACTCTGCTTGGAGGTGG + Intronic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152697984 17:81805807-81805829 CCGGCGACACAGCTGGTAGGTGG - Intronic
1153357513 18:4153966-4153988 GAAGAGACACACATGGAAGGTGG + Intronic
1153741926 18:8138384-8138406 CAGAAGACAGGGTTGGAAGGGGG - Intronic
1153843748 18:9030317-9030339 AAGGGGACAAAACTGGAAGGCGG + Intergenic
1154024635 18:10696018-10696040 CAGGAAACACAGTTGCATGGAGG + Intronic
1154388839 18:13919141-13919163 CAGCAGGCACAGCTGTAGGGAGG + Intergenic
1156012531 18:32511616-32511638 CTGGAGAGACAGCGGGACGGAGG + Intergenic
1156229093 18:35136672-35136694 CAGGAGACAAGGCTGCAGGGTGG + Intronic
1156414311 18:36871823-36871845 CAGCAGACACAGCTGGAAATGGG + Intronic
1156457113 18:37301058-37301080 CAGGAGACACAGGAGGAGGCAGG + Intronic
1156864278 18:41871672-41871694 GAGGTCACACAGCTGGAATGTGG - Intergenic
1156924849 18:42563856-42563878 CAGGAGACAGAGCAGGAAGAAGG + Intergenic
1157282332 18:46354219-46354241 CAGGGGACACCTCTTGAAGGAGG + Intronic
1157475793 18:48022643-48022665 CAGGAGACACTGGTGGAGAGGGG + Intergenic
1157491106 18:48124498-48124520 CAGAGGAGCCAGCTGGAAGGGGG + Intronic
1157615569 18:48985558-48985580 CAGGAGAAAAAGGTGCAAGGAGG - Intergenic
1157701512 18:49763935-49763957 CAGGAGCCTCAGCTGTAAAGTGG + Intergenic
1158556682 18:58480912-58480934 CAGGAGACTCAAGTGGAATGAGG + Intergenic
1159879814 18:73847981-73848003 CAGGAGACAGAGCTGTGAGAAGG - Intergenic
1160070394 18:75623081-75623103 GAGGAGACACAGGGAGAAGGTGG + Intergenic
1160391148 18:78534194-78534216 AAGGAGACACAGCTGTGTGGGGG - Intergenic
1160616040 18:80129533-80129555 TACCAGACACATCTGGAAGGAGG - Intronic
1160797834 19:953965-953987 CAGGAGACCGAGGTGGGAGGTGG + Intronic
1160843796 19:1157837-1157859 CAAGAGAGAGAGCTGGGAGGCGG - Intronic
1161055818 19:2190216-2190238 CACGAGACACAGCAGGACCGGGG - Intronic
1161197752 19:2996473-2996495 CTGGAGACACCGCAGGAAAGGGG - Intergenic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161575558 19:5052584-5052606 CAGGAGATGGAGCTGGGAGGCGG - Intronic
1162143008 19:8595956-8595978 CAGGAGCCTCAGCTGGATGGGGG + Intronic
1162379644 19:10323804-10323826 AAGGCCACACAGCTGGAGGGAGG + Intronic
1162389109 19:10378415-10378437 CAGGTGGCTCAGCTGGAAAGGGG + Exonic
1162958385 19:14112411-14112433 CTGCAGCCACAGCTGGAAGGTGG + Intronic
1162996032 19:14335924-14335946 TAGGTCACACAGCTTGAAGGTGG + Intergenic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163173847 19:15551064-15551086 CAGGACACACAGCTAGTAAGAGG + Intronic
1163328452 19:16620315-16620337 CAGCGGACACAGCTGGAAGGAGG - Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164890603 19:31820186-31820208 CACAAGACCCAGCTGGAAGAGGG - Intergenic
1165114006 19:33518185-33518207 CAGGAGACAGAGGTGCAAGGTGG - Intronic
1165393174 19:35549852-35549874 AAGGAGACACCGCTGGGGGGTGG + Intergenic
1165549846 19:36574231-36574253 AAGGCGGGACAGCTGGAAGGTGG + Intronic
1165595477 19:37008784-37008806 CGGGAGACACAGCAAGAGGGAGG - Intronic
1166019023 19:40008140-40008162 AAGGTCACACAGCTGGTAGGTGG + Intronic
1166140152 19:40800996-40801018 CAGGAGGCAGAGCGGGAGGGTGG + Exonic
1166199951 19:41231045-41231067 CAGGTGACAGAGTTGGGAGGTGG + Exonic
1166342340 19:42146222-42146244 CTGGAGACACAGATGGAACCAGG + Intronic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1166778581 19:45327583-45327605 AAAGTCACACAGCTGGAAGGGGG + Intergenic
1167200411 19:48061464-48061486 CAGGCCACACAGCTGGTAAGTGG + Intronic
1167322720 19:48806451-48806473 CAAGAGACACAGCAAGGAGGAGG + Intronic
1167360529 19:49028135-49028157 CAGGAGCCACAGCAGGAGGATGG - Intronic
1167363119 19:49040665-49040687 CAGGAGCCACAGCAGGAGGATGG + Intergenic
1167365448 19:49052921-49052943 CAGGAGCCACAGCAGGAGGATGG - Intergenic
1167576665 19:50320956-50320978 CAGGGGGCACAGCTGGGAGAGGG + Intronic
1167634495 19:50646627-50646649 CAGAAAACACAACTGGTAGGAGG + Intronic
1168037319 19:53730344-53730366 CAGGAGACTGAGGTGGGAGGTGG - Intergenic
1168084190 19:54033319-54033341 GTGGAGACACAGCAAGAAGGCGG - Intergenic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1168317687 19:55491162-55491184 CAGGAGGCAGAGCTGGGAGCAGG - Intronic
1168351426 19:55678340-55678362 CAGGGGCCCCAGCAGGAAGGAGG + Intronic
1168411392 19:56142327-56142349 AAGGACACAGAGCTGGTAGGAGG + Intronic
1202712244 1_KI270714v1_random:24986-25008 CAGGCCACACAGCTAGAGGGTGG + Intergenic
924999215 2:391834-391856 GATGATACACAGCTGGGAGGTGG + Intergenic
925190229 2:1876487-1876509 CAGGAGCCCCAGATGGACGGGGG - Intronic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925642463 2:5999135-5999157 CTGGAAACACAGCCAGAAGGTGG - Intergenic
925720479 2:6821892-6821914 CAGGAAACAAAGACGGAAGGAGG - Intergenic
926083240 2:10005541-10005563 CAGGACACACACATGGGAGGGGG - Intergenic
926181771 2:10651120-10651142 CAGGAGGCAGGGCTGGAGGGTGG - Intronic
926294229 2:11556517-11556539 AAGGTGAAACAGCTGCAAGGAGG - Exonic
926302758 2:11616384-11616406 CATGAGGCACAGCTGCAAGCTGG - Intronic
926378099 2:12254607-12254629 AAGGCCACACAGCTGGCAGGTGG - Intergenic
926620329 2:15041426-15041448 CAAGAGAAACAGCTGCAGGGTGG + Intergenic
927012449 2:18919240-18919262 CAGGAGACACAGCTGACACTGGG + Intergenic
927518940 2:23687821-23687843 CAGGGGACGCGGCTGGAGGGAGG + Intronic
927787440 2:25983109-25983131 CGAGAGAATCAGCTGGAAGGTGG - Intergenic
928795028 2:35007773-35007795 CAGGATAAACAGGTGAAAGGAGG + Intergenic
929892517 2:45930122-45930144 CAGGTGACTGAGCTGGATGGAGG - Intronic
930736756 2:54787440-54787462 CAGGCCACACAGCTGGTAAGTGG - Intronic
931217457 2:60260003-60260025 CAGGAGACCCAGGAGGAAGCTGG - Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931707026 2:64955097-64955119 CAGATCACACAGCTGGAAAGTGG - Intergenic
932177263 2:69614346-69614368 CAGGTGTAACAGCTGGAAGGAGG + Intronic
932196136 2:69785702-69785724 CAGGTCACACAGCTAGAAAGAGG + Intronic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
933688550 2:85161808-85161830 CAGGAGCCAGGGCTGGAAGCAGG + Intronic
934026776 2:88007584-88007606 AAGGAGACACATCTGGCATGTGG - Intergenic
934474706 2:94586576-94586598 AAGGAGCCACAGCTGGATCGGGG - Intergenic
935419478 2:102852702-102852724 AAGGAGACACAGCTTGGAAGTGG - Intergenic
935590936 2:104844992-104845014 GAGGAGGAAGAGCTGGAAGGGGG - Intergenic
935922749 2:108033119-108033141 CAGGAGAGAAGGCTGGAAGTGGG + Intergenic
936062150 2:109301936-109301958 CAGGAGAGGCTGCGGGAAGGAGG - Intronic
936072787 2:109382518-109382540 CTGGGGACACAGCTGCAAGACGG - Intronic
936376547 2:111946065-111946087 CAGGGAGCACAGATGGAAGGAGG + Intronic
936514686 2:113174233-113174255 CGGGACACAGAGCAGGAAGGGGG - Intronic
936588680 2:113782109-113782131 TAGGAGACACATCAGGAAAGGGG + Intergenic
936928119 2:117758666-117758688 CAGGAGACAGAGGTTGAAGTGGG + Intergenic
937085284 2:119167595-119167617 CATGAAACACAGCTGTAATGAGG + Intergenic
937152529 2:119695873-119695895 AAGGCCACACAGCTGGATGGGGG - Intergenic
937198063 2:120177658-120177680 CAGGAGACACTGCTGAACAGAGG + Exonic
938070845 2:128307395-128307417 CATGTGACTCAGCTGGAAGATGG + Intronic
938871159 2:135477878-135477900 CAGGAGGCTGAGGTGGAAGGAGG + Intronic
938930173 2:136079864-136079886 GTGAAGACACAGCAGGAAGGTGG - Intergenic
939956326 2:148530446-148530468 CAGAGGACACAGCAAGAAGGTGG + Intergenic
940867200 2:158829352-158829374 CAGGAGACACAGCTGCAAAAGGG + Intronic
941686114 2:168450767-168450789 CAGGAGAACCACCTGGGAGGTGG + Intergenic
942230320 2:173855057-173855079 CAGGAGGGACAGCTGGCAGGAGG - Intergenic
944373822 2:199016311-199016333 CAGGAAAGACATCTGGAAAGTGG - Intergenic
947638818 2:231694459-231694481 CAGGGGACAAAGCTGGGACGGGG + Intergenic
947658788 2:231851095-231851117 AAGGTGACACAGCTAGAAAGCGG + Intergenic
947862697 2:233373112-233373134 CAGGTCACAAAGCTGGAAAGTGG + Intronic
948046555 2:234950676-234950698 CAGGAGACACAGGTGGACAGAGG - Intergenic
948305431 2:236943884-236943906 CAGGACACACAGCTGGTTTGAGG + Intergenic
948335394 2:237203196-237203218 CAGGAGTGACGGCTGGGAGGTGG - Intergenic
948337420 2:237221448-237221470 CAGGTCACACAGCTGGTAGCGGG + Intergenic
948622423 2:239244748-239244770 CAGGAGGCTGAGCTGGGAGGAGG - Intronic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948933466 2:241147899-241147921 CAGGAGGCACAGCGGGAAAAAGG - Intronic
948949091 2:241237206-241237228 CAGGAGAGGCAGTGGGAAGGGGG + Intronic
1169264976 20:4162075-4162097 CAGGAGGCACACCTGCCAGGAGG - Intronic
1169389447 20:5177747-5177769 CAGGAAACACCTCAGGAAGGGGG - Intronic
1169443765 20:5654475-5654497 GAGAAGACACAACTGGAAAGGGG - Intergenic
1169729981 20:8776294-8776316 AAGGATCCACAACTGGAAGGTGG + Intronic
1170006492 20:11675599-11675621 CAAGAGACCAAGCTGTAAGGTGG - Intergenic
1170273957 20:14562735-14562757 CAAGAGACCCAGCAAGAAGGAGG - Intronic
1170627534 20:18041081-18041103 AAGGTGACACAGCTGGCAGGTGG + Intronic
1170836503 20:19889141-19889163 CAGGAAATCCTGCTGGAAGGGGG - Intronic
1170868809 20:20185561-20185583 CAGGAAAGACAGCTGGGTGGAGG + Intronic
1171178113 20:23070144-23070166 CACAAGAGACATCTGGAAGGGGG + Intergenic
1171851186 20:30309278-30309300 AAGGCCACACAGCTGTAAGGTGG - Intergenic
1172127734 20:32635105-32635127 CAGGAGAATCACCTGGGAGGCGG + Intergenic
1172853272 20:37981973-37981995 CAGGAAACACAGGTGAGAGGAGG + Intergenic
1173301629 20:41808822-41808844 CAGGAGGCAGAGCTTGGAGGCGG - Intergenic
1173326566 20:42038841-42038863 CAGCAGAGACTGCTGGATGGTGG + Intergenic
1173395892 20:42679020-42679042 CAGCAGACCCAGCAGGAATGAGG + Intronic
1173532403 20:43780465-43780487 AAGGACACACAGCTGGAAAGTGG + Intergenic
1173667111 20:44771032-44771054 AAGGTCACACAGCAGGAAGGGGG + Intronic
1174342326 20:49905794-49905816 CAGAAGCCACAGCGGGAAGTGGG + Exonic
1174375107 20:50121382-50121404 AAGGTCACACAGCTGGTAGGTGG - Intronic
1174452305 20:50627959-50627981 CAGGGCACACAGCTGGGAGAGGG + Intronic
1174576933 20:51543229-51543251 CAGGAGGCATAGCTGTAACGGGG - Intronic
1174721764 20:52820331-52820353 CAGAAGAAACAGCAGGAATGGGG + Intergenic
1174820711 20:53724534-53724556 CAGGAGACAGAGGTTGAAGTGGG - Intergenic
1175013719 20:55765836-55765858 CAGGAGAGAGAGCATGAAGGAGG + Intergenic
1175201029 20:57277773-57277795 CAGGGGCCCCAGCTGGAAGTTGG - Intergenic
1175238894 20:57532028-57532050 CAGGAAAAACAGCTGGGAGTGGG + Intergenic
1175248918 20:57597280-57597302 CTGGGGCCACAGCTGGAAGCCGG + Intergenic
1175739797 20:61412650-61412672 GAGAAGGCAGAGCTGGAAGGTGG - Intronic
1175780460 20:61679191-61679213 GAGGAGACAGAGATGGAAGGTGG - Intronic
1175837921 20:62008232-62008254 CAGGCGACAAGGCGGGAAGGCGG + Intronic
1175994956 20:62807915-62807937 CAGGAGACAGGGCTGGCATGGGG - Intronic
1177595980 21:23243762-23243784 GCGGAGACTCAGCTGGAAGTAGG + Intergenic
1178468528 21:32870946-32870968 CAGAGGACACAGCTGGTAAGTGG - Intergenic
1178673528 21:34612780-34612802 CATGAGCAACAGCTGGAAGCTGG - Intronic
1178802401 21:35808218-35808240 AAGGTGACACAGCTGGGAAGTGG + Intronic
1178887558 21:36495863-36495885 GAGGAGACACAGGGGGAAGAGGG + Intronic
1179301751 21:40118061-40118083 CAGGAGATGCAGCTGGATTGTGG + Intronic
1179613371 21:42566360-42566382 CAGCTGACAAAGCTGGGAGGAGG - Intronic
1179937159 21:44613083-44613105 CAGGGGACCCAGCAGGCAGGTGG - Intronic
1180026583 21:45166794-45166816 AAGAAGACAGAGCTGGGAGGTGG - Intronic
1180053455 21:45344544-45344566 CTGGACACACAGCTGGGGGGAGG + Intergenic
1180206926 21:46266462-46266484 AAGGAGACAGAACTGGAAGGAGG + Intronic
1180568178 22:16692867-16692889 CAGGGGACAAAGGTGGAAGCTGG + Intergenic
1180815516 22:18787081-18787103 GAGGTCACACAGCTGGGAGGTGG - Intergenic
1181201706 22:21221416-21221438 GAGGTCACACAGCTGGGAGGTGG - Intronic
1181531397 22:23519449-23519471 GGGGACACACAGCTGGAAGGTGG - Intergenic
1181567443 22:23747947-23747969 CAGGGGCCACATCTGGGAGGGGG - Intronic
1181700051 22:24615555-24615577 GAGGTCACACAGCTGGGAGGTGG + Intronic
1181784041 22:25213248-25213270 AAAGAGTCAGAGCTGGAAGGAGG - Intergenic
1183020908 22:35024945-35024967 GAGAAGACAAAGCAGGAAGGGGG + Intergenic
1183305337 22:37080056-37080078 CAGGAGAGGAAGCTGGCAGGAGG + Intronic
1183341917 22:37286298-37286320 AAGGTGACACAGCTGGAGGGTGG - Intronic
1183499718 22:38171449-38171471 CAGGAGGCTGAGGTGGAAGGAGG - Intronic
1183582100 22:38732153-38732175 AACTAGAAACAGCTGGAAGGAGG - Exonic
1183792236 22:40081586-40081608 CAGGTGACAAAGCTGGAAAGTGG - Intronic
1184658274 22:45952923-45952945 CAGCAGACACAGCTGGGAGGCGG - Intronic
1184738548 22:46413268-46413290 CAGGACACACAACTGGAAACAGG + Intronic
1184743448 22:46442492-46442514 CAGGAGCCACAGCTGGGGGCAGG - Intronic
1184866518 22:47204611-47204633 CAGGGGACAAAGCTGCAGGGCGG - Intergenic
1185065097 22:48628153-48628175 GAGGTGACGCAGCTGGCAGGAGG + Intronic
1185094868 22:48800701-48800723 CAGCAGACACAGGTGGCTGGAGG + Intronic
1203225208 22_KI270731v1_random:74012-74034 GAGGTCACACAGCTGGGAGGTGG + Intergenic
1203265619 22_KI270734v1_random:12772-12794 GAGGTCACACAGCTGGGAGGTGG - Intergenic
949214555 3:1550242-1550264 CAGGAGACAGAGAGTGAAGGGGG - Intergenic
949217162 3:1583634-1583656 CTGGAGTCAATGCTGGAAGGGGG + Intergenic
949473029 3:4416597-4416619 AAGGTTACACAGCTGGAAAGCGG - Intronic
950143729 3:10633126-10633148 AAGGTCACACAGCTGGGAGGTGG - Intronic
950184300 3:10935590-10935612 CAGGAGATACAGCAGGTAGACGG - Intronic
950236271 3:11323378-11323400 AAGGGTACACAGCTGGTAGGAGG - Intronic
950447901 3:13048648-13048670 CTGGACACACCCCTGGAAGGAGG + Intronic
950739427 3:15038164-15038186 CAGTAGATACAGGTGGAAAGGGG - Intronic
950765264 3:15268595-15268617 CAGGAGCCAAGCCTGGAAGGGGG + Intronic
951129895 3:19029878-19029900 CAGGAGCTACAGCTGGAATGGGG - Intergenic
951184852 3:19701843-19701865 AAGGAGAAACAGCTGGCAGGAGG + Intergenic
951462636 3:22968061-22968083 CAGGAGCCACAGCTGGCTGGTGG + Intergenic
951694031 3:25427419-25427441 CAGAACACACAGCTGGTAAGTGG + Intronic
952606826 3:35157765-35157787 CAGGAGACAAAACTTGAAGCTGG - Intergenic
952843502 3:37667816-37667838 CAGGAGAAACACCTGGTGGGAGG + Intronic
952916597 3:38250379-38250401 AAGGTCACACAGCTGGAAAGAGG + Intronic
953236732 3:41113567-41113589 TGGGAGGCAGAGCTGGAAGGAGG - Intergenic
953476757 3:43211875-43211897 CAGAAGGTACAGGTGGAAGGCGG + Intergenic
953563997 3:44015476-44015498 CTGGAGGCCCAGCTGGGAGGAGG - Intergenic
953878752 3:46680876-46680898 CAGGAGACGCAGCTGGGGTGAGG + Intronic
953881105 3:46691901-46691923 AAGGACAAACAGGTGGAAGGGGG + Intronic
953908572 3:46881104-46881126 CAGGACACACAACTGGTAAGCGG + Intronic
954097091 3:48337279-48337301 CAGAAGGCAAAGCAGGAAGGAGG - Intergenic
954196577 3:49000687-49000709 CACCAGGCACAGCTGGTAGGTGG - Intronic
954678365 3:52327757-52327779 CAGGTGAGAGAGCTGCAAGGTGG - Intronic
954840555 3:53507959-53507981 CATCAGACACAGCTGGAAAGGGG + Intronic
954900498 3:54015012-54015034 CTGGAGCCACAGCTGGAAGGTGG + Intergenic
955053652 3:55437149-55437171 CCAGAGACACAGCTCGAAGGGGG + Intergenic
955352076 3:58200999-58201021 CGTGAAACACCGCTGGAAGGCGG - Exonic
955514535 3:59713655-59713677 CAGGAGACAGAGAGGGAAGTAGG + Intergenic
955537525 3:59940060-59940082 CAGGTCCCACAGCTGGAAAGTGG - Intronic
956424383 3:69118298-69118320 GAGGAGACACAGCTAGGAAGTGG - Intronic
957674509 3:83349559-83349581 AGGCAGACACAGCTGGAAAGTGG + Intergenic
957717143 3:83942718-83942740 GAGGAGACGCAGCTGGATGTTGG - Intergenic
957973741 3:87416928-87416950 GTGGAGACACAGCAAGAAGGTGG + Intergenic
959057158 3:101578745-101578767 CAGGACACAGAGCTAGAATGGGG - Intronic
959435472 3:106309972-106309994 CAGGAGAGAGAGCGAGAAGGTGG + Intergenic
959524905 3:107365851-107365873 CAAGAGACCCAGCTGGCAGCTGG + Intergenic
960639969 3:119815020-119815042 CAGTTGACACAGCTCGAAAGCGG - Exonic
960747730 3:120908387-120908409 AGGGAGCCACAGCTGGACGGCGG - Intronic
960951850 3:123004316-123004338 CAAGAGGCACAGCTGGAAAAAGG + Intronic
961165365 3:124759928-124759950 TAGGAGAGACAGCTGTGAGGGGG - Intergenic
961323020 3:126091400-126091422 AAGGAGAGACAACTGGAAGTGGG + Intronic
961465672 3:127079605-127079627 CAGGAGACATAGATGGAGAGTGG + Intergenic
961490558 3:127254210-127254232 CTGGAGACACTGCTGAAAAGGGG + Intergenic
961609311 3:128123929-128123951 CCGGAGACACAGACGGAAGTGGG - Intronic
962625390 3:137220796-137220818 CATGAGAAACAGTTGGCAGGAGG + Intergenic
962851385 3:139310807-139310829 CAGGAAACAGAACTGGGAGGCGG + Intronic
962922152 3:139959922-139959944 CAGGAGAATAAGCTGGTAGGGGG - Intronic
964027132 3:152088161-152088183 CAGGAAAAACAGCAGGATGGGGG + Intergenic
964447061 3:156770616-156770638 CAGGACACACAGCCAGAAAGTGG + Intergenic
964506713 3:157407586-157407608 CAGGAGACAGAATTGGAATGAGG - Intronic
964527798 3:157633364-157633386 GCAGAGACACAGCTAGAAGGTGG + Intronic
964768807 3:160203432-160203454 CAGGAGAGACATATGGGAGGAGG + Intergenic
964914684 3:161826209-161826231 AAGGAGACATAGCTGTAAAGAGG - Intergenic
965647441 3:170898501-170898523 CAGGAGAGACAGCAAGCAGGGGG - Intronic
965706394 3:171512156-171512178 CAGGCGACAGAGCACGAAGGTGG - Intergenic
965814868 3:172625872-172625894 CAGGAGAGACATCTGGAAGGAGG + Intergenic
965834906 3:172840636-172840658 CAGGAGACACAGGGTGAAAGGGG - Intergenic
965942492 3:174201496-174201518 GAGAAGGCAGAGCTGGAAGGTGG - Intronic
966243568 3:177781313-177781335 CATGAGATACCGCTGGGAGGAGG + Intergenic
966439273 3:179925993-179926015 CAGGAGAAACATTTGGAGGGGGG - Intronic
966735335 3:183182559-183182581 TAGGAGACAAAGCAGGAGGGGGG + Intronic
966807849 3:183820311-183820333 CAGGTCCCAGAGCTGGAAGGTGG + Intronic
966946683 3:184781755-184781777 CAAGAGACACAACTGGAAAATGG + Intergenic
967090657 3:186132361-186132383 CAGCAGATCCAGGTGGAAGGAGG + Intronic
967874543 3:194258163-194258185 CAGGAGGCCCAGCTGGGATGAGG - Intergenic
968705419 4:2075308-2075330 CAGGTGACACAGCAGCAATGAGG + Intronic
969109644 4:4835778-4835800 CAGGAGGCTGAGGTGGAAGGAGG + Intergenic
969109925 4:4838272-4838294 CTGGAGACACAGTTGTGAGGGGG - Intergenic
969235180 4:5860502-5860524 AAGGAGACACAGCTGGGAAGTGG - Intronic
969338091 4:6523316-6523338 CAGGCCACACAGCAAGAAGGAGG - Intronic
969436304 4:7191551-7191573 CAAGGGACCCAGCTGGGAGGTGG + Intergenic
969525593 4:7702428-7702450 AAGGCCTCACAGCTGGAAGGTGG - Intronic
969578179 4:8048521-8048543 CAGGTCACACAGCTGGGAGGAGG + Intronic
969629085 4:8324943-8324965 CAGGATGCACAGCTGGAGGGTGG + Intergenic
969664641 4:8550025-8550047 CAGGAGACAGAGCAGGAAATGGG - Intergenic
969674308 4:8606664-8606686 CGTGAGACCCATCTGGAAGGAGG + Intronic
970469541 4:16363104-16363126 GATGAGACACAATTGGAAGGAGG - Intergenic
971340151 4:25760939-25760961 AAGGTTACACAGCTGGAAAGTGG + Intronic
972380929 4:38519706-38519728 AAAGAGACTCAGCTGGAGGGAGG + Intergenic
972587167 4:40448632-40448654 GAGGAGACACAGCTAGTAAGTGG - Intronic
972641480 4:40929371-40929393 CAGGAGACAGAGCTTGCAGTGGG - Intronic
972829758 4:42801820-42801842 CAGGAGAAAGAGCGAGAAGGGGG + Intergenic
973274671 4:48294073-48294095 CAGGTGACACAGCAAGAAGGTGG + Intergenic
973897680 4:55431592-55431614 CAGGAGTCCCTGTTGGAAGGGGG - Exonic
974606629 4:64160200-64160222 CAGGAGAGAGAGAGGGAAGGCGG - Intergenic
975246988 4:72130957-72130979 CAGGATAGAGAGCTGGAACGGGG + Intronic
975306939 4:72860680-72860702 CAGTAGACACAGCAGGCAGATGG - Intergenic
976140016 4:81981449-81981471 CAAGTGACACAGCTGGTAAGTGG - Intronic
977030537 4:91876842-91876864 CAGGACACACTGATGGAAGAGGG - Intergenic
977068112 4:92345033-92345055 CAGGGGAGAAAGCTGAAAGGAGG - Intronic
977728243 4:100322232-100322254 CAGGAGAGAGAGCAAGAAGGGGG + Intergenic
978184303 4:105839044-105839066 TAAGAGACAGAGCTGGAAGTGGG - Intronic
978482542 4:109210741-109210763 CAGGGGAAACAGCTGGAACATGG - Intronic
978787970 4:112630976-112630998 CAAGGGTCAAAGCTGGAAGGTGG - Intronic
980015589 4:127646374-127646396 CAGGAAACACCACTGAAAGGGGG - Intronic
980043530 4:127965071-127965093 TAGGCGACACACCTGGAAGCAGG - Exonic
980410546 4:132413116-132413138 CAGGAGACACAGAGTGAAGGGGG - Intergenic
981073197 4:140566954-140566976 AAGGTCACACAGCTGGGAGGGGG - Intronic
981572046 4:146162241-146162263 CAGGAGACAGAGAGGGATGGGGG - Intergenic
982972354 4:162005190-162005212 CAGGAAACAGAGCTGGAAGTTGG - Intronic
983235047 4:165169965-165169987 AAGGTAACACAGCTGGAAAGTGG - Intronic
983830652 4:172322626-172322648 CAGGAGAGAGAGCGTGAAGGTGG + Intronic
983998429 4:174213511-174213533 CAGGGGGCTCAGTTGGAAGGTGG + Intergenic
984287750 4:177755206-177755228 GAGGTGACACAGCTGGCGGGTGG + Intronic
984565867 4:181329511-181329533 CAGAAGACAGAGTTGGAAGTTGG - Intergenic
984850932 4:184152031-184152053 CAGCAGACACAGCTTCAGGGGGG - Intronic
984973489 4:185210134-185210156 CAGGATCCCCAGCAGGAAGGCGG - Intronic
985096406 4:186416933-186416955 CAGGAGACAGAGAAGGAAGCTGG + Intergenic
985624351 5:977309-977331 CAAGAGCCCCAGCTGGAGGGTGG - Intergenic
985723476 5:1502715-1502737 CAGGAGACACAGATCGCAGTTGG + Intronic
986286068 5:6360068-6360090 GAGGGGAGAGAGCTGGAAGGAGG + Intergenic
986775023 5:11006423-11006445 CCAGAGCCACAGATGGAAGGAGG + Intronic
988056908 5:26108948-26108970 GAGGAGACAGAGCTGGAAGGAGG + Intergenic
988492775 5:31718573-31718595 AAGCAGACACAGCAAGAAGGTGG - Intronic
989197124 5:38726483-38726505 CAGGTCACACATCTGGCAGGTGG - Intergenic
989588355 5:43090682-43090704 CAGGAGGCACAGCTGGACTAGGG + Intronic
989780772 5:45262404-45262426 CATGAGTGACAGCTGGGAGGCGG + Exonic
990122058 5:52466943-52466965 CAGCAGACATAGCCGGGAGGTGG - Intergenic
990619977 5:57549434-57549456 AAGGACACAGAGCTGGATGGAGG - Intergenic
990994491 5:61717906-61717928 AAGGAGAAGCAGGTGGAAGGTGG - Intronic
991127719 5:63086413-63086435 CAGGTCACACAGCTAGTAGGTGG - Intergenic
991293792 5:65060102-65060124 CAAGAGTCAAGGCTGGAAGGTGG + Intergenic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
994152475 5:96463741-96463763 AAGCAGAGACAGATGGAAGGGGG - Intergenic
994565376 5:101439433-101439455 CAGGAGAGACAGAGTGAAGGAGG - Intergenic
995407988 5:111823396-111823418 CAGGAGACAGAGCTAGACTGGGG - Intronic
995450139 5:112291320-112291342 CAGGAGGAACAGCTGGCATGGGG - Intronic
995608317 5:113881878-113881900 CAGGAGAGAGAGATAGAAGGAGG - Intergenic
996192939 5:120567687-120567709 CAGGAGACAGAGAGTGAAGGGGG - Intronic
996650314 5:125867928-125867950 CAGAAGAGACAGCAGGAAGCTGG + Intergenic
997363082 5:133307660-133307682 CAGGAGACTCACGTGGAAGTGGG + Intronic
997465995 5:134088437-134088459 TGGGAGAGACAGCTGGAAGGGGG + Intergenic
997487103 5:134240503-134240525 GAGGTGACACTGTTGGAAGGAGG + Intergenic
997736810 5:136218935-136218957 AAGGTCACACAGCTGGAAAGTGG + Intronic
997844996 5:137278205-137278227 CAGGATACAGGGCTGCAAGGTGG - Intronic
998432652 5:142079730-142079752 CAGTAGCCACAGATGGCAGGTGG - Intergenic
998897667 5:146817186-146817208 GATGAGTCACAGCTGGAAGGAGG - Intronic
999102755 5:149040361-149040383 CAGGACACACAGATGCTAGGGGG - Intronic
999241418 5:150130028-150130050 GAGGAGAAACTGGTGGAAGGAGG + Intronic
999504222 5:152178703-152178725 GAGGAGAGAAAGATGGAAGGAGG + Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000537500 5:162497058-162497080 AAGGTCACACAGCTGGTAGGTGG - Intergenic
1001524384 5:172418372-172418394 AAGGCCACACAGCTGGAGGGTGG + Intronic
1001542991 5:172552147-172552169 CCTGAGACACAGCAGGAAGGTGG - Intergenic
1001555839 5:172636711-172636733 CAGGTCACACAGCTAGAAGGGGG - Intergenic
1001685881 5:173594772-173594794 AAGAACACACAGCTGGTAGGGGG + Intergenic
1001821653 5:174715041-174715063 AAGGCCACCCAGCTGGAAGGAGG + Intergenic
1002065683 5:176650602-176650624 CAGCAGACCCAGCAGGCAGGAGG + Intronic
1002181150 5:177431719-177431741 CAGGAGACAATGCAGGGAGGTGG + Intronic
1002204502 5:177553764-177553786 CAGGAGACACAGCTGCTGAGGGG + Intronic
1002319377 5:178365897-178365919 CAGTGAACACAGCAGGAAGGGGG + Intronic
1002593639 5:180307641-180307663 CTTGAGACACAGCAGGAAAGAGG - Intronic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1002971101 6:2021035-2021057 CAGGAGAAGCAGCTGGGAGAAGG - Intronic
1003011051 6:2427892-2427914 AAGCAGACAGAGGTGGAAGGAGG - Intergenic
1003528699 6:6919989-6920011 GAGGAGATGCCGCTGGAAGGAGG - Intergenic
1004180556 6:13377484-13377506 CAGGGCACACAGCAGGAAAGTGG - Intronic
1005058859 6:21757651-21757673 CAGGAGAATCACCTGGGAGGCGG - Intergenic
1005876042 6:30010231-30010253 CAGGAAAGAGACCTGGAAGGAGG - Intergenic
1006510900 6:34520503-34520525 AAGGTCACACAGCAGGAAGGAGG - Intronic
1006638491 6:35476344-35476366 CAGGAGCCGCAGCCGGGAGGAGG + Exonic
1007124631 6:39415418-39415440 GAGGAGACACACCTGTAAGGTGG - Intronic
1007218262 6:40258345-40258367 GAGGGGACCCAGCTGGAATGTGG + Intergenic
1007791257 6:44310018-44310040 CAGAAGACACAGCAGTAAGCAGG - Intronic
1008481616 6:51992042-51992064 CAGGACCCACAGCTGGAAAGTGG - Intronic
1008852927 6:56046757-56046779 CAGAAGCCACAGCTAGACGGCGG + Intergenic
1008870843 6:56270791-56270813 CAGGAGACAGAGCATGAGGGAGG - Intronic
1009399532 6:63237879-63237901 CAAGAGAGACAGTAGGAAGGGGG + Intergenic
1010189803 6:73183489-73183511 CTGGACACAGAGCTGGATGGCGG - Intronic
1010254692 6:73744756-73744778 CAGAAGACACATTTGAAAGGAGG - Intronic
1010498560 6:76566729-76566751 CAGGGCACACTGCTGCAAGGGGG + Intergenic
1010875652 6:81101956-81101978 CAGGAGAGACAGAGTGAAGGGGG - Intergenic
1011066527 6:83332742-83332764 CTGGAGACTCAGATGGGAGGAGG + Intronic
1011712359 6:90067476-90067498 CAGGAGACACTCATGCAAGGAGG + Intronic
1013091899 6:106907752-106907774 GAGGAGACACAGGGAGAAGGTGG + Intergenic
1013279834 6:108625729-108625751 AAGGCCACACAGCTGGCAGGTGG - Intronic
1015347141 6:132174004-132174026 CAGGAGAGAGAGACGGAAGGGGG + Intergenic
1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG + Intronic
1016916201 6:149246770-149246792 CAGGAGGCTGAGCTGGGAGGAGG - Intronic
1017494939 6:154975349-154975371 AAGGAGAAACACCTGGAGGGAGG + Intronic
1017950301 6:159130377-159130399 CCAGAGACACACCTGGCAGGAGG + Intergenic
1018212612 6:161496781-161496803 AGGGAGACACAGCAAGAAGGTGG + Intronic
1019162414 6:170077698-170077720 CAGAGGACACAGCGAGAAGGCGG - Intergenic
1019497822 7:1348631-1348653 CGGGAGACAGAGCTGCACGGAGG - Intergenic
1019663089 7:2236562-2236584 CAGGAGACCCAGCTAAAATGAGG + Intronic
1019758993 7:2794997-2795019 CGGGACGTACAGCTGGAAGGTGG + Exonic
1019801209 7:3089613-3089635 CAGGAGACCCCTCTGGAGGGAGG + Intergenic
1019978441 7:4603214-4603236 CAGGAGACACATCAGGGAGGAGG - Intergenic
1021031596 7:15744212-15744234 CAGCACACAAAGCAGGAAGGGGG - Intergenic
1021274725 7:18636265-18636287 CAGGGGACACAGCAGTAAGAGGG - Intronic
1021380977 7:19965772-19965794 CAGCAGTCACTCCTGGAAGGGGG + Intergenic
1021511475 7:21437555-21437577 TATGAGACAAAGCTGGGAGGTGG + Intronic
1022097423 7:27149538-27149560 CAAGAGGCACTCCTGGAAGGCGG + Intronic
1022394200 7:29971176-29971198 CAGGTCACACAGCTAGTAGGTGG - Intronic
1022474098 7:30699255-30699277 CAGGGGCCACCGATGGAAGGTGG - Intronic
1022487464 7:30790839-30790861 CAGGTGACACAGTTGGTAGGTGG + Intronic
1022805474 7:33816984-33817006 CAAGTCACACAGATGGAAGGTGG + Intergenic
1023473661 7:40552772-40552794 CAGGAAACAAAGCTGGGTGGTGG - Intronic
1023962379 7:44937722-44937744 CAGCAGTCTCAGCTGGCAGGGGG - Intergenic
1024427184 7:49239859-49239881 GAGGCAACACAGCTGGAAGTTGG + Intergenic
1024455201 7:49598004-49598026 CTGGAGACGAAGCTGGAAGTGGG + Intergenic
1026024604 7:66734346-66734368 CAGAATACACAGCTAGGAGGTGG - Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1026888406 7:73967947-73967969 CAGGAGACCCACCTGGAGGCTGG - Intergenic
1026977944 7:74510035-74510057 CAGCAGGAACAGCTTGAAGGAGG - Intronic
1027600758 7:80237757-80237779 CAGGAGAAAGAGCATGAAGGGGG + Intergenic
1027648129 7:80830773-80830795 GAGGTGACACAGCTGGCAGGTGG + Intronic
1028738003 7:94239870-94239892 CAGGAGCCTGAGCTGGGAGGAGG + Intergenic
1029171198 7:98630154-98630176 CAGGTACCACACCTGGAAGGCGG - Intergenic
1029216195 7:98951914-98951936 CAGGAGACACAGCCTGGAGAAGG - Intronic
1029516175 7:101024715-101024737 GAGGAGACAGAGCAGGGAGGAGG - Intronic
1029715201 7:102321833-102321855 CCAGAGACAGAGCTGCAAGGGGG - Intergenic
1029914074 7:104188875-104188897 CAGGAGAGAGAGCATGAAGGGGG - Intronic
1030613364 7:111712867-111712889 AAGGAGTGAGAGCTGGAAGGAGG - Intergenic
1032451935 7:132039122-132039144 CAGGTCACACAGCTAGTAGGTGG + Intergenic
1032467463 7:132155260-132155282 CAGGTTACACAGCAGGGAGGTGG - Intronic
1033431155 7:141290872-141290894 GAAGGGACACAGCTTGAAGGTGG - Intronic
1034042882 7:147897954-147897976 CAGAAGACACAGCTTCAGGGTGG + Intronic
1034313274 7:150108891-150108913 CTGGAGAGGCAGCTGCAAGGTGG + Intergenic
1034405865 7:150902105-150902127 CAGGACACACAGAAGGAAGGAGG + Intergenic
1034456863 7:151175379-151175401 CAGGAGAGCCACCCGGAAGGAGG - Intergenic
1034793587 7:153991777-153991799 CTGGAGAGGCAGCTGCAAGGTGG - Intronic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1035276673 7:157752142-157752164 CTGCAGACACAGCAGGCAGGTGG - Intronic
1035330482 7:158093616-158093638 AAGAAGACATAGCTGGAATGAGG - Intronic
1035911712 8:3574312-3574334 CAGGAGGCAGAGCTTGAAGTGGG - Intronic
1035946137 8:3965189-3965211 CAGGAGACAAGGGCGGAAGGAGG + Intronic
1035954901 8:4066224-4066246 CAGGAGACAAAGAAGGAAGGAGG - Intronic
1037071222 8:14651979-14652001 CAGGAAACACAGCTGGTAGTAGG - Intronic
1037273043 8:17150894-17150916 CAGTAGACACAGCGAAAAGGTGG + Intergenic
1037595029 8:20347841-20347863 CAGGAGAGACAGCAAGAAGGGGG + Intergenic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038012577 8:23486737-23486759 CAGGATTAACACCTGGAAGGGGG + Intergenic
1038023690 8:23571099-23571121 CAGGACTCACGCCTGGAAGGTGG - Intronic
1038432509 8:27511510-27511532 CTGGACACCCAGCTGGAAGATGG + Intronic
1038739476 8:30204301-30204323 AAGGTGAGACAGCTGGAAGGTGG + Intergenic
1039702569 8:39977729-39977751 GGGGAGGCACAGCTGGAAGGAGG - Intronic
1040097137 8:43456946-43456968 CAGGAGAAAAAGCTGGCAGAAGG - Intergenic
1041390958 8:57347227-57347249 CAGGAGAGACAGCTGGCGGCAGG - Intergenic
1041782625 8:61594403-61594425 CAGGAGACACTGATGCAAGCTGG - Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1042952835 8:74219381-74219403 CAGGAGATGCAGCTGGAAAGAGG + Intergenic
1043913805 8:85896642-85896664 CAGGACACACACCAGAAAGGAGG + Intergenic
1044804235 8:95988496-95988518 AAAGACACACAGCTGGTAGGTGG + Intergenic
1046374416 8:113357809-113357831 CAGGAGACAGAGAGGAAAGGGGG - Intronic
1047248559 8:123165046-123165068 AAGGAGACCCAGGAGGAAGGCGG + Intergenic
1047248637 8:123165549-123165571 CAGGGGTCACAGCTGGACTGTGG + Intergenic
1047307499 8:123664789-123664811 CAGGTCACACAGCTGGTAAGTGG - Intergenic
1047312307 8:123702817-123702839 CAGGACTCACAGCTTAAAGGTGG + Intronic
1047511611 8:125520256-125520278 GAGGAGCCACAGGAGGAAGGAGG + Intergenic
1047665968 8:127091432-127091454 AAGTGGACACAGCAGGAAGGTGG + Intergenic
1047680458 8:127249241-127249263 CAGGAGACAGAGCTTGCAGTGGG - Intergenic
1047757728 8:127931596-127931618 CAGATCACACAGCTGGAAAGTGG + Intergenic
1047761835 8:127960279-127960301 CAGGTCACACAGCTTGAGGGTGG + Intergenic
1047893787 8:129342995-129343017 ATGGAGACACAGTAGGAAGGAGG + Intergenic
1048282099 8:133113238-133113260 AAGGACACACAGCTAGAAGGAGG + Intronic
1048352747 8:133629297-133629319 CAGGTTACACAGCTGGGAAGGGG - Intergenic
1048360817 8:133695739-133695761 AAGGAGACGCAGCTGGTAGATGG + Intergenic
1048709664 8:137195207-137195229 AGGGAGACAGAGCGGGAAGGAGG + Intergenic
1048733468 8:137470860-137470882 CAGGGCACAGAGCTGGAAAGGGG + Intergenic
1048809180 8:138269686-138269708 AAGGCCACACAGCTGGAAAGTGG - Intronic
1048819567 8:138368351-138368373 AAGGTCACACAGCTGGAAAGCGG - Intronic
1048968304 8:139629728-139629750 CTGGGGACACAGCAGGAAGGTGG - Intronic
1048988351 8:139747529-139747551 CAGGAGTCAGAGCAGGTAGGGGG + Intronic
1048988571 8:139748358-139748380 CAGGAGTCAGAGCAGGTAGGGGG + Intronic
1049149029 8:141022508-141022530 AAGGCGACACAGCTGGAGAGAGG - Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1051104733 9:13566488-13566510 CAGAGTACACAGCTGGCAGGTGG + Intergenic
1051767587 9:20541520-20541542 CAGGAGAGACAGCACAAAGGAGG + Intronic
1052415513 9:28172060-28172082 CAGTAGCCACAGCAGGAAAGTGG - Intronic
1052571806 9:30235123-30235145 CAGGAGAGAGAGCGTGAAGGGGG + Intergenic
1053157291 9:35790564-35790586 CTGGAGAAATAGCTTGAAGGGGG + Intergenic
1053280785 9:36818738-36818760 GAGGAGAGACAGCTGGAGAGAGG - Intergenic
1053354074 9:37431804-37431826 AAGGTCACACAGCTAGAAGGAGG + Intronic
1053683356 9:40499525-40499547 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1053788960 9:41672558-41672580 AAGGCCACACAGCTGTAAGGTGG - Intergenic
1053826563 9:42030700-42030722 CAGGAGAGACAGCTGCAGGTGGG - Intronic
1053904848 9:42831131-42831153 CAGGAGGCTCAGGTGGGAGGTGG + Intergenic
1053933336 9:43127840-43127862 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054156179 9:61642209-61642231 AAGGCCACACAGCTGTAAGGTGG + Intergenic
1054177242 9:61883903-61883925 AAGGCCACACAGCTGTAAGGTGG - Intergenic
1054280358 9:63125403-63125425 AAGGAGCCACAGCTGGATCGGGG - Intergenic
1054296460 9:63335023-63335045 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054394477 9:64639528-64639550 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054429126 9:65144727-65144749 AAGGAGCCACAGCTGGATCGGGG + Intergenic
1054475950 9:65573210-65573232 AAGGCCACACAGCTGTAAGGTGG + Intergenic
1054501257 9:65876808-65876830 AAGGAGCCACAGCTGGATCGGGG - Intergenic
1054603997 9:67156697-67156719 CAGGAGAGACAGCTGCAGGTGGG + Intergenic
1054660291 9:67696902-67696924 AAGGCCACACAGCTGTAAGGTGG + Intergenic
1055402661 9:75941125-75941147 CAGGAGCGCCCGCTGGAAGGAGG - Intronic
1056192628 9:84199165-84199187 CAGGGCACACTGGTGGAAGGGGG + Intergenic
1056204433 9:84306346-84306368 CAGGCGAGACTGTTGGAAGGCGG - Intronic
1056411040 9:86327484-86327506 AAGGACACACAGCTGGGAAGTGG + Intronic
1056424902 9:86466362-86466384 CAGGAGGCAGAGCTAGATGGTGG - Intergenic
1057147511 9:92768212-92768234 CAGGAGAAGCAGCTGGATGTCGG - Intergenic
1057560630 9:96125455-96125477 CAAGAGTCACAGCTAGAAAGCGG - Intergenic
1057952885 9:99384161-99384183 CAGGAGACAATGCTGGAAAGGGG + Intergenic
1058002101 9:99876332-99876354 CAGGAGAGAGAGCGAGAAGGGGG + Intergenic
1058472960 9:105299825-105299847 CAGCAGACACAGCAGGCAGCAGG - Intronic
1058776489 9:108289318-108289340 CTGGAGAAGCAGATGGAAGGGGG - Intergenic
1058923954 9:109643513-109643535 CAGGAGACTCAGAGGGAATGTGG - Intronic
1059051174 9:110927025-110927047 CAGGTGACTCAGATGCAAGGTGG + Intronic
1059404951 9:114093737-114093759 CAGGTGACACAGCTAGTAGGTGG + Intronic
1059444026 9:114327229-114327251 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1059445233 9:114334008-114334030 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1059449023 9:114358303-114358325 TAGGTCACACAGCTAGAAGGTGG - Intronic
1059578821 9:115521415-115521437 TAGGAGACGAAGCTGGCAGGAGG + Intergenic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1059988836 9:119845420-119845442 AAGGACACACAGCCTGAAGGTGG - Intergenic
1060000681 9:119955798-119955820 AAGGAGACACAGCTAGTAAGTGG + Intergenic
1060007351 9:120012347-120012369 CAGCAGGCACAGCTGGTAGCAGG + Intergenic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060521232 9:124295144-124295166 CATGAGCCACTCCTGGAAGGTGG - Intronic
1060550438 9:124482455-124482477 CAGGAGAGAGAGCTGGGAGCAGG + Exonic
1060556525 9:124510776-124510798 CAGGTCACACAGCTAGAAAGTGG - Intergenic
1060720348 9:125972392-125972414 AAGGACACACAGCTGACAGGAGG - Intergenic
1060831404 9:126719941-126719963 CAGGAGACCCACCTGTAATGAGG - Intergenic
1061059759 9:128244607-128244629 GAGGAGGCACAGATGGATGGGGG - Intronic
1061249062 9:129415999-129416021 CTGGGGACACAGCTGGAAGATGG + Intergenic
1061510322 9:131057087-131057109 CAGGGGACACAGCTGGCATAGGG - Exonic
1061888055 9:133602972-133602994 CAGCAGACTCAGCTGAAAGGAGG - Intergenic
1062277282 9:135736932-135736954 CTGGAGACACGGCAGGAAGCAGG - Intronic
1062469398 9:136695937-136695959 CAGGATGCACAGAGGGAAGGGGG - Intergenic
1185484165 X:469575-469597 CCGCAGACACAGAGGGAAGGCGG - Intergenic
1186817893 X:13255984-13256006 CAGGAGAAACTGGTGGAATGGGG - Intergenic
1187257179 X:17654185-17654207 CAGGAGACCAGGATGGAAGGGGG - Intronic
1187393236 X:18899269-18899291 CAAGAGACACAGCAGAGAGGAGG + Intronic
1188845342 X:35065394-35065416 GAGGACACGTAGCTGGAAGGAGG + Intergenic
1189172831 X:38925986-38926008 CAGCACACACAGCAGGAAGTGGG - Intergenic
1190119037 X:47645403-47645425 CAAGTCACACAGCTGGAAGTTGG + Intronic
1190338289 X:49276405-49276427 CAGGTCACACAGCTGATAGGTGG + Intronic
1190485022 X:50915470-50915492 AAGGACACACAGCTGGTATGTGG - Intronic
1190965927 X:55301549-55301571 CAGGAGACCCATCTGACAGGCGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1193498842 X:82247407-82247429 CAGGAGAGAGAGAGGGAAGGGGG - Intergenic
1195214174 X:102681116-102681138 CAGGAGAGACTACTGGAAGGTGG - Intergenic
1195598572 X:106720722-106720744 AAGGTCACACAGCTGGTAGGTGG - Intronic
1196194687 X:112827231-112827253 CAAGAGACAAAGATGGCAGGAGG - Intronic
1196385998 X:115151882-115151904 CAGGAGACAGAGCTGGAGCCAGG + Intronic
1196647530 X:118133795-118133817 AAGAACACACAGCTGGAATGTGG - Intergenic
1196739407 X:119011293-119011315 AAGGAGGCACAGCTGAAAGGAGG - Intronic
1197114267 X:122813982-122814004 CATGAGAAACAGGTGGACGGTGG - Intergenic
1197302799 X:124802128-124802150 AAGGGGACAGAACTGGAAGGAGG - Intronic
1197946144 X:131841339-131841361 TAAGGGCCACAGCTGGAAGGTGG - Intergenic
1198385156 X:136122245-136122267 CAGGAGTCACAGATGCAAAGGGG - Intergenic
1198744822 X:139879003-139879025 CAGGAGGCTGAGCTGGGAGGAGG + Intronic
1199273953 X:145920963-145920985 CAGGAGAGACAGAGCGAAGGGGG - Intergenic
1199616554 X:149660311-149660333 TAAGGGACACAGCTGGAAGCAGG + Intergenic
1199626087 X:149742937-149742959 TAAGGGACACAGCTGGAAGCAGG - Intergenic
1200049892 X:153423183-153423205 GAGGGGACAGGGCTGGAAGGAGG - Intergenic
1200141840 X:153906398-153906420 CCGGAGGCACCTCTGGAAGGTGG + Exonic
1201567933 Y:15385920-15385942 CAGGAGAAAGAGGGGGAAGGGGG - Intergenic