ID: 1134081719

View in Genome Browser
Species Human (GRCh38)
Location 16:11329290-11329312
Sequence GTCACACTGCTCCAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134081714_1134081719 4 Left 1134081714 16:11329263-11329285 CCCTGGAAGAGTTTTTATGTAAA 0: 1
1: 0
2: 3
3: 35
4: 340
Right 1134081719 16:11329290-11329312 GTCACACTGCTCCAGGGGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 197
1134081715_1134081719 3 Left 1134081715 16:11329264-11329286 CCTGGAAGAGTTTTTATGTAAAT 0: 1
1: 0
2: 0
3: 35
4: 369
Right 1134081719 16:11329290-11329312 GTCACACTGCTCCAGGGGAAAGG 0: 1
1: 0
2: 0
3: 23
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134081719 Original CRISPR GTCACACTGCTCCAGGGGAA AGG Intronic
900284691 1:1893484-1893506 CTCACACTGCAACAGGGGGAGGG - Intergenic
902037506 1:13468282-13468304 GCCATACTGCCCCAGGGTAAGGG + Intergenic
903787317 1:25870066-25870088 GGGACTCTGATCCAGGGGAAAGG + Intronic
905452034 1:38063102-38063124 TTTGCACTGCTCCAGGGGCAGGG + Intergenic
907008411 1:50939597-50939619 GTCCCAGTTCTCAAGGGGAATGG + Intronic
907431111 1:54412078-54412100 GTCACTCTTCTCCAAGGTAAAGG + Intronic
912387943 1:109281862-109281884 GGCACACTGCTCCAGCTGAGCGG + Exonic
915483745 1:156205438-156205460 CTCATACTGCTCCAGGGTACTGG + Intronic
917212083 1:172641667-172641689 GTCCCACTGCTCCAGGCATAAGG - Intergenic
920336533 1:205248943-205248965 GCCACACTGCAGGAGGGGAAGGG - Intronic
920645725 1:207802619-207802641 GACACAGTGCTCCATGGGAAAGG + Intergenic
921907256 1:220508332-220508354 GTCACACTGCTCCTGGCCATGGG + Intergenic
922271729 1:224041844-224041866 GTCTGACTACGCCAGGGGAAGGG - Intergenic
1062786992 10:273028-273050 GTCACACTGCTTCTGTGGAGAGG - Intergenic
1066221029 10:33336134-33336156 GTCACACGCCTCCTGGGGATTGG + Intronic
1067463426 10:46475505-46475527 GTGAAACTGCTCTAGGGGATGGG - Intergenic
1067623769 10:47909133-47909155 GTGAAACTGCTCTAGGGGATGGG + Intergenic
1067684558 10:48458771-48458793 TTCACAAAGCTCCAGAGGAAGGG + Intronic
1068113144 10:52705339-52705361 TACACACTGCTCCAGGGGCTAGG - Intergenic
1070416846 10:76198418-76198440 TGCACTCTGCTCCAAGGGAATGG - Intronic
1074190738 10:111133725-111133747 GTTCCACTTCTCAAGGGGAATGG + Intergenic
1074230882 10:111533674-111533696 GTAACACTGCTTTAGGGGAGGGG + Intergenic
1074475229 10:113767714-113767736 GTCTCACTGTTCCAGGGGCTAGG + Intronic
1075411867 10:122234133-122234155 CTCTCTCTGCTCCAGGGGACAGG + Intronic
1075448823 10:122533134-122533156 GTCACACAGCTCCTGAGGAGGGG + Intergenic
1076511168 10:131014565-131014587 ATGACAGTTCTCCAGGGGAAAGG + Intergenic
1076946522 10:133655522-133655544 GTCACACTGCACTGGGAGAATGG - Intergenic
1077099631 11:816340-816362 CTCAACCTGCTCCAAGGGAAAGG - Intergenic
1078339747 11:10490170-10490192 GTCACACTACAGCAGGTGAAGGG + Intronic
1078565844 11:12413335-12413357 ATGACTGTGCTCCAGGGGAAGGG + Intronic
1079168677 11:18070996-18071018 GTCAGGCTTCTCCAAGGGAACGG + Intronic
1079721877 11:23825819-23825841 GGCACACTGATGCAGGGGATGGG + Intergenic
1084868859 11:72082076-72082098 GTTAAACTGCCCCAGGGAAAAGG + Intronic
1085879641 11:80451153-80451175 GTTCCACTGCTCTAGGTGAAGGG - Intergenic
1088186446 11:107176627-107176649 GTCCCACGGCACCACGGGAAAGG + Intergenic
1089618176 11:119706984-119707006 CTCACCCAGCTCCAGGGGGAGGG - Intronic
1089852356 11:121510700-121510722 GTCCCACTGCTCAGGAGGAAAGG + Intronic
1090890154 11:130916201-130916223 TTCACACTGCCCCAGGCGGAAGG + Exonic
1092201049 12:6583141-6583163 GGCCCACTGCTCTAGTGGAACGG + Intronic
1095089320 12:38088959-38088981 GTCACACTGCTCTGGGAGAATGG + Intergenic
1099113305 12:78590241-78590263 GTCTCACAGCTCCATGAGAATGG + Intergenic
1099722613 12:86383186-86383208 GTCACGCTGATGCAGGGGATGGG - Intronic
1099858999 12:88205417-88205439 GTCACACTGATTCAGGAGATGGG - Intergenic
1101515425 12:105430454-105430476 TTCACACTGCTTCTTGGGAAGGG - Intergenic
1103157834 12:118702061-118702083 GACACACTGCTCCTGTGGACTGG + Intergenic
1106425537 13:29625267-29625289 GTGACAGAGCCCCAGGGGAAGGG + Intergenic
1106938521 13:34750487-34750509 GACAGACTGCTCCAAGGGAGGGG - Intergenic
1109889417 13:68588948-68588970 CTCACTCTTCACCAGGGGAATGG + Intergenic
1111102955 13:83611415-83611437 GTCACACTGATACAAGGGATGGG + Intergenic
1113671636 13:112179524-112179546 GTGACACTGCTCCATGGTGATGG - Intergenic
1114867561 14:26615835-26615857 GTCCCAGTTCTCAAGGGGAATGG - Intergenic
1115121678 14:29944213-29944235 ATGATACTGCTCCAGGGGCAGGG - Intronic
1115594215 14:34893731-34893753 AACACACTGCTTGAGGGGAACGG - Intergenic
1118601089 14:67471941-67471963 CTCTCACTCCTCAAGGGGAAGGG - Exonic
1119262488 14:73245853-73245875 CTCACCCTGCTCCCGGGGACTGG + Intronic
1202924302 14_KI270724v1_random:9504-9526 GTCACACTGCGCTGGGAGAATGG + Intergenic
1124590657 15:31050352-31050374 ATCACCCTTCCCCAGGGGAAGGG - Intronic
1126159016 15:45592141-45592163 GTGACACTTCTCCAGATGAAGGG + Exonic
1127124278 15:55797069-55797091 GTCACACTGCTTCTAGGTAATGG - Intergenic
1127132376 15:55880939-55880961 CACACACTGGTCCAGGGAAAGGG - Intronic
1127906587 15:63380686-63380708 GTCACAGTGCCCATGGGGAAGGG - Intronic
1128397446 15:67242606-67242628 ATTATACTGCTCCAGTGGAAAGG + Intronic
1129717306 15:77859889-77859911 GTCCAGCTGCACCAGGGGAAGGG + Intergenic
1129753918 15:78084487-78084509 GTCACACTGCCCCAGGAGCAGGG + Intronic
1130461730 15:84164410-84164432 GTCTGGCTGCTCCAGGGGAAGGG - Intergenic
1132728515 16:1349198-1349220 TTCACACTGGGCCTGGGGAAGGG - Exonic
1133339057 16:5025160-5025182 GTCTCCCTCCTCCTGGGGAAGGG - Exonic
1134081719 16:11329290-11329312 GTCACACTGCTCCAGGGGAAAGG + Intronic
1135894495 16:26386574-26386596 GACACTCTTCTCCAGGAGAAAGG + Intergenic
1138429416 16:56959149-56959171 GAGACACAGCTCCTGGGGAAGGG - Intergenic
1138824131 16:60298336-60298358 CTCACACTTCTTCAGGTGAAAGG + Intergenic
1141503730 16:84461616-84461638 GCCTCACTGCTCCTGGGGCATGG - Intronic
1203080596 16_KI270728v1_random:1144564-1144586 GTTGCCCGGCTCCAGGGGAATGG - Intergenic
1142552455 17:749307-749329 GTCACACGGCCACAGGGTAATGG + Intronic
1142552493 17:749576-749598 ATCACACGGCTACAGGGTAATGG + Intronic
1142552512 17:749710-749732 GTCACACAGCCACAGGGTAATGG + Intronic
1142933078 17:3304484-3304506 CTCACACTGCTCTAGAGGTAAGG + Intergenic
1144338894 17:14297144-14297166 CTCCCACTGCTCCTTGGGAATGG - Intergenic
1144508847 17:15857582-15857604 GTCACACTGATCCAAGGGGTAGG - Intergenic
1145172962 17:20675222-20675244 GTCACACTGATCCAAGGGGTAGG - Intergenic
1145995364 17:29101994-29102016 GTCACATTGCTTCAGAGGAGGGG - Intronic
1146693557 17:34892826-34892848 CTCAGGCTGCTGCAGGGGAAGGG - Intergenic
1147807645 17:43143456-43143478 GTCACACTGCTCCTGGGATGGGG + Intergenic
1149048092 17:52270856-52270878 GTCTCATTTCTCCAGAGGAATGG - Intergenic
1149430493 17:56593260-56593282 GTTGCATTGCTCCAGGAGAAAGG + Intergenic
1149868891 17:60165598-60165620 ATCCCACGGCTCCTGGGGAAGGG - Intronic
1150639277 17:66938790-66938812 CTCGCACTGCTGCAGGGGACAGG - Intergenic
1151875179 17:76863984-76864006 TTCACCCTGCTCAAGGGGAGGGG - Intergenic
1152037388 17:77881553-77881575 GCCACTGTGCTCCAGGAGAAGGG - Intergenic
1203170567 17_GL000205v2_random:144934-144956 GTCACACTGCGCTGGGAGAATGG - Intergenic
1155083359 18:22431759-22431781 GTCAAATTGCTCCAGGGAAACGG - Intergenic
1157505435 18:48222948-48222970 GCCACACAGCTCCAGGGGCAGGG - Intronic
1161396033 19:4045423-4045445 GTCACCCAGCCCCAGGGGAGAGG + Exonic
1165285177 19:34835866-34835888 GACAAACTGCTCCAGGGAGAGGG - Intergenic
1168143198 19:54403298-54403320 GTCACAGTTCTCAAGAGGAAGGG - Intergenic
925920873 2:8637006-8637028 GTCACACTCGGCCAGGGTAATGG + Intergenic
927398955 2:22688688-22688710 GTCACACTTCTCCAGCTGAAGGG - Intergenic
929297936 2:40269755-40269777 GTCACAGTGATCCATGAGAAAGG - Intronic
932400787 2:71479688-71479710 TGCCCACTGCTCCAGAGGAAGGG + Intronic
934554145 2:95278556-95278578 GTCAGACTGGGCCAGGGGATGGG + Intronic
934619334 2:95794374-95794396 AGCACACTGTTCCAGGGAAACGG + Intergenic
934641558 2:96030183-96030205 AGCACACTGTTCCAGGGAAACGG - Intronic
936597829 2:113866181-113866203 GTCACACTGATCCAAGGAACAGG - Intergenic
937983647 2:127628939-127628961 GTCACACAGCTCAAGGGGGTGGG + Intronic
944038195 2:195323187-195323209 GTTACAATGCTCCACGGAAAAGG - Intergenic
945120744 2:206454821-206454843 GGCACACTGATGCAGGGGATGGG + Intronic
947579652 2:231307145-231307167 CTCACAGTGCCCCAGGGGCAGGG + Intronic
1168840754 20:908581-908603 CACCCACTGCTCCAGGGGCAAGG + Intronic
1168853247 20:990756-990778 GTCACTCGCCTCCAGGGGCAGGG + Intronic
1172222677 20:33284559-33284581 CTCACACTGCTCCAGGGCACAGG + Intronic
1172315717 20:33952652-33952674 CTCTCACTGCTCTAGGGAAAGGG + Intergenic
1173315921 20:41942974-41942996 GTGACTCTGAGCCAGGGGAAGGG - Intergenic
1174785515 20:53428934-53428956 GTCACATTGCTCCAGGTAGATGG + Intronic
1175579157 20:60085935-60085957 GTCACTCAGCTCCAGGGAAAGGG - Intergenic
1175639270 20:60613924-60613946 GTCTCGCTGCTCCTGGTGAAGGG - Intergenic
1175798076 20:61784948-61784970 GCCCCTCTGCTCCAGGGGTAGGG - Intronic
1176331158 21:5549441-5549463 GTCACACTGCGCTGGGAGAATGG + Intergenic
1176396599 21:6271510-6271532 GTCACACTGCGCTGGGAGAATGG - Intergenic
1176440558 21:6717594-6717616 GTCACACTGCGCTGGGAGAATGG + Intergenic
1176464820 21:7044663-7044685 GTCACACTGCGCTGGGAGAATGG + Intergenic
1176488381 21:7426442-7426464 GTCACACTGCGCTGGGAGAATGG + Intergenic
1177599289 21:23289505-23289527 GTCACACTGATACAAGGGATGGG - Intergenic
1181407392 22:22694592-22694614 GTGACCCTGCTGCAGGGGGAGGG + Intergenic
1181415390 22:22755359-22755381 GTGACCCTGCTGCAGGGGGAGGG + Intronic
1181592297 22:23892997-23893019 GTCACAGTGGTCCAGGCCAAAGG + Intronic
1182423803 22:30261435-30261457 GGCACAGAGCTCCAGGGCAAGGG - Intergenic
1182532704 22:30972991-30973013 GTCACAGTGGTCCACTGGAATGG - Intergenic
1182541749 22:31046844-31046866 AGGACACTGCTCCAGGGGAGGGG + Intergenic
1183399775 22:37595772-37595794 GTCACACTTCCCCTGGGGAAGGG + Intergenic
1184557107 22:45239617-45239639 GTCACACAGCTGCAGGGACATGG - Intronic
1185162911 22:49240283-49240305 TTTGCACTGCTGCAGGGGAAGGG - Intergenic
950424844 3:12919522-12919544 GTGACACTGTTCAAGGAGAAGGG + Intronic
950484007 3:13262141-13262163 GCCACACTTCCCCAGGTGAACGG + Intergenic
950720809 3:14881437-14881459 GCCAGACAGCTCCTGGGGAAGGG - Intronic
951039982 3:17979360-17979382 GTCACACAGCTGCTGGGGTAGGG + Intronic
952474111 3:33687891-33687913 CCCACACTGCTCTAGGGGTAGGG + Intronic
954980489 3:54741091-54741113 GTCTCACTGATCCAGAGGCAGGG + Intronic
955778689 3:62461354-62461376 GTCACACAGCTCCTTGGTAAGGG + Intronic
957080951 3:75634955-75634977 GTCACACTGCGCTGGGAGAATGG + Intergenic
957252645 3:77793592-77793614 GCCGCACTGCTTCAGGGCAATGG + Intergenic
957342878 3:78923426-78923448 GTCACTCTGGTCCTGGGGAAAGG - Intronic
957474886 3:80709965-80709987 GGGACACAGCACCAGGGGAAGGG + Intergenic
962253421 3:133853538-133853560 TGCACCCTGCCCCAGGGGAATGG + Intronic
962535948 3:136328835-136328857 CTCGCACTGCTGCAGGGAAAGGG - Exonic
967264404 3:187677555-187677577 TTTCCACTGTTCCAGGGGAAGGG - Intergenic
968089494 3:195891635-195891657 GTCACTTTGCTCCAGGGACAGGG - Intronic
969859680 4:10025818-10025840 CTCCCACTGACCCAGGGGAAAGG + Intronic
970845447 4:20532576-20532598 GTCACACCTCCCCAGGGGCATGG - Intronic
971097869 4:23428402-23428424 GTCACACTGATCCTGGGCAGTGG + Intergenic
977040627 4:92012955-92012977 GTTCCACTTCTCAAGGGGAATGG - Intergenic
980136742 4:128865358-128865380 GGAACACTGCTTTAGGGGAAAGG + Intronic
985449940 4:190056181-190056203 GTCACACTGCACTGGGAGAATGG - Intergenic
985551704 5:536870-536892 GTCACAATGCTCAGGGAGAAAGG - Intergenic
985551719 5:537087-537109 GTCACAATGCTCAGGGAGAAAGG - Intergenic
989609393 5:43276868-43276890 CTCACACCGATCCAAGGGAAGGG + Intronic
990525661 5:56624438-56624460 GCCTCCCTGCTCCAGAGGAAAGG - Intergenic
992150397 5:73896831-73896853 GTCACGGTGTGCCAGGGGAATGG - Intronic
995133811 5:108659125-108659147 GTGACTCTGCTCCAGAGGAAAGG - Intergenic
995778302 5:115748740-115748762 ACCACAAGGCTCCAGGGGAAAGG - Intergenic
997437202 5:133884132-133884154 CTCCCTCTGCTCCAGGAGAAGGG + Intergenic
998185256 5:139974413-139974435 GTCACTTTGAGCCAGGGGAAGGG + Intronic
999071359 5:148747161-148747183 GTCTAAATGCTCCAGGGGATGGG - Intergenic
999386353 5:151156924-151156946 GTCACACTGCAACAGGGGCTGGG + Intronic
1000312915 5:160062390-160062412 GCCACAGTGCTCCGGGGGATGGG - Intronic
1000938656 5:167333690-167333712 GTCCCTTTGCTCCAGGGGGAAGG + Intronic
1001654547 5:173339612-173339634 GCCACACTGCTGCAGGTAAAAGG - Intergenic
1008498949 6:52161270-52161292 GTCACACTGATCCAAGGGGTGGG - Intergenic
1009705856 6:67251390-67251412 GTCACACTGTTCCAAGGTCACGG - Intergenic
1012808395 6:103925640-103925662 GACACACTTTTCAAGGGGAAGGG + Intergenic
1013670133 6:112392646-112392668 GTCACACACCTCCAGTTGAAAGG + Intergenic
1017779525 6:157705364-157705386 GTCCCACTTTTCTAGGGGAAGGG - Intronic
1020804633 7:12773285-12773307 GTCATAGTTCTCAAGGGGAATGG - Intergenic
1022015484 7:26345419-26345441 CTCTGACTGCTCCAGGGGAGAGG + Intronic
1023635964 7:42210483-42210505 TTCACACTGCTCTGGGGGCAGGG - Intronic
1023947031 7:44811295-44811317 GCCAGACTGCTCCACTGGAAAGG + Intronic
1024281702 7:47724227-47724249 GTCTCACTCCTCTAGGGGTATGG - Intronic
1024376014 7:48638952-48638974 GTCACACAACTCCAAGGGAATGG - Intronic
1026311238 7:69186407-69186429 GGAACACCGCTCCTGGGGAAAGG - Intergenic
1027704420 7:81510786-81510808 GTCACACTGATCCAAGAGATGGG - Intergenic
1028323334 7:89490580-89490602 GTCACACTCCTGCAAGGGCATGG + Intergenic
1033252057 7:139768850-139768872 TGCACACTGCTACAGGGGAAGGG + Intronic
1033440464 7:141373668-141373690 GGCAGGCTGCTCCCGGGGAAGGG + Intronic
1035263704 7:157676986-157677008 CTCACACAGCACCAGGGGAGGGG - Intronic
1039033966 8:33338797-33338819 CTGCCACTGCTCCAGGAGAAGGG - Intergenic
1039049265 8:33478323-33478345 GTCCCTCTTCTCCAGGGGCAGGG - Intronic
1040342380 8:46447485-46447507 GGCACCCTGCTCCAAAGGAAGGG + Intergenic
1041894517 8:62908091-62908113 GTCACACTGATGCAAGGGAGGGG - Intronic
1045739389 8:105337268-105337290 TTCACACTGCTGCAGGGGTAAGG + Intronic
1046505950 8:115138360-115138382 GTGCCACTTTTCCAGGGGAATGG + Intergenic
1046826123 8:118694316-118694338 GTCACACTGATGCAAGGGATGGG + Intergenic
1048870881 8:138796779-138796801 ATCACACTCCTCCAAGGGAATGG - Intronic
1048878064 8:138852201-138852223 GTCACCCTGCAGCAGGGGGAGGG + Intronic
1048937601 8:139369831-139369853 GGTACACTGACCCAGGGGAATGG + Intergenic
1049337510 8:142094286-142094308 GTCACACAGCTGCAGGTGGAGGG - Intergenic
1051012850 9:12439326-12439348 CTCACACTGCTCCAGCTGACAGG - Intergenic
1051024524 9:12591330-12591352 GTTTCACTGCTCCCAGGGAAAGG + Intergenic
1051684805 9:19646935-19646957 GGCAGACTTCTACAGGGGAATGG - Intronic
1051760224 9:20455373-20455395 GTGACACTGTTCCAGTGGAAGGG + Intronic
1052500183 9:29279399-29279421 GTTTCACTTCTCCAGGGGAATGG + Intergenic
1052826077 9:33176078-33176100 CTCCCCCTGCTCCAGGGGCAGGG + Intergenic
1058869871 9:109192311-109192333 ATCACCCGGCTCCAGGGTAAAGG + Exonic
1059904516 9:118967423-118967445 GTCAGACTGCCCCAGAGGTAAGG + Intergenic
1060720715 9:125975060-125975082 TTTACACTTCTGCAGGGGAACGG + Intergenic
1062237015 9:135515189-135515211 CTCACTCTGCACCTGGGGAAGGG - Intergenic
1203430943 Un_GL000195v1:90885-90907 GTCACACTGCGCTGGGAGAATGG - Intergenic
1203435565 Un_GL000195v1:133742-133764 GTCACACTGCGCTGGGAGAATGG + Intergenic
1186293631 X:8125410-8125432 GTCACAATGCTCCTGGGATAGGG - Intergenic
1186838613 X:13462950-13462972 ATCACTAAGCTCCAGGGGAAGGG + Intergenic
1188240129 X:27776318-27776340 TTTCCACTGCTCCAGGAGAATGG - Intergenic
1189295322 X:39913703-39913725 GTCACAATGCTACATGGAAAGGG - Intergenic
1190436788 X:50433492-50433514 GTTACAGGGCTCTAGGGGAATGG + Intronic
1193585737 X:83318994-83319016 GTCACACTGATGCAGAGGATGGG - Intergenic
1194893336 X:99407101-99407123 GTCACACTGCTGCAAGAGATGGG - Intergenic
1195424403 X:104712213-104712235 GGCAGACTGCTCCAGGGAAAAGG - Intronic
1195791699 X:108595234-108595256 CTCACACTCTACCAGGGGAAAGG - Intronic
1195884577 X:109625278-109625300 GTCTCGCTGCTCCAGGGAAAGGG + Intronic
1197871551 X:131067166-131067188 GTCACAAGGCCCAAGGGGAAAGG + Intronic
1198154347 X:133944003-133944025 GTCATACTGTTGCAGGGGAAGGG + Intronic
1201865641 Y:18650918-18650940 GTTCCACAGCTCCAGGAGAAGGG + Intergenic
1202377540 Y:24250740-24250762 GTCTGGCTGCTCCAGGGGAAGGG + Intergenic
1202493241 Y:25419382-25419404 GTCTGGCTGCTCCAGGGGAAGGG - Intergenic