ID: 1134085682

View in Genome Browser
Species Human (GRCh38)
Location 16:11356022-11356044
Sequence GCCTGCTATAAACTACACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134085682_1134085692 25 Left 1134085682 16:11356022-11356044 CCCCTGTGTAGTTTATAGCAGGC No data
Right 1134085692 16:11356070-11356092 GGAGTGCTCTTTAAGCACAGAGG No data
1134085682_1134085689 2 Left 1134085682 16:11356022-11356044 CCCCTGTGTAGTTTATAGCAGGC No data
Right 1134085689 16:11356047-11356069 GAGGGTGCTGGCTAGACTGTTGG No data
1134085682_1134085690 3 Left 1134085682 16:11356022-11356044 CCCCTGTGTAGTTTATAGCAGGC No data
Right 1134085690 16:11356048-11356070 AGGGTGCTGGCTAGACTGTTGGG No data
1134085682_1134085687 -10 Left 1134085682 16:11356022-11356044 CCCCTGTGTAGTTTATAGCAGGC No data
Right 1134085687 16:11356035-11356057 TATAGCAGGCCTGAGGGTGCTGG No data
1134085682_1134085691 4 Left 1134085682 16:11356022-11356044 CCCCTGTGTAGTTTATAGCAGGC No data
Right 1134085691 16:11356049-11356071 GGGTGCTGGCTAGACTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134085682 Original CRISPR GCCTGCTATAAACTACACAG GGG (reversed) Intergenic
No off target data available for this crispr