ID: 1134086675

View in Genome Browser
Species Human (GRCh38)
Location 16:11362133-11362155
Sequence TGATACTATTAGAGTTATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 212}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134086665_1134086675 0 Left 1134086665 16:11362110-11362132 CCCCACCCCCATGGACCGAGAGG No data
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1134086670_1134086675 -6 Left 1134086670 16:11362116-11362138 CCCCATGGACCGAGAGGTGATAC No data
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1134086667_1134086675 -1 Left 1134086667 16:11362111-11362133 CCCACCCCCATGGACCGAGAGGT 0: 1
1: 0
2: 0
3: 7
4: 68
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1134086669_1134086675 -5 Left 1134086669 16:11362115-11362137 CCCCCATGGACCGAGAGGTGATA No data
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1134086668_1134086675 -2 Left 1134086668 16:11362112-11362134 CCACCCCCATGGACCGAGAGGTG No data
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1134086664_1134086675 1 Left 1134086664 16:11362109-11362131 CCCCCACCCCCATGGACCGAGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1134086663_1134086675 2 Left 1134086663 16:11362108-11362130 CCCCCCACCCCCATGGACCGAGA No data
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1134086672_1134086675 -8 Left 1134086672 16:11362118-11362140 CCATGGACCGAGAGGTGATACTA No data
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1134086662_1134086675 5 Left 1134086662 16:11362105-11362127 CCTCCCCCCACCCCCATGGACCG No data
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212
1134086671_1134086675 -7 Left 1134086671 16:11362117-11362139 CCCATGGACCGAGAGGTGATACT No data
Right 1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG 0: 1
1: 0
2: 1
3: 19
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134086675 Original CRISPR TGATACTATTAGAGTTATAT GGG Intronic
904188913 1:28728200-28728222 GGATACTTTTAGAGACATATAGG - Intergenic
904731236 1:32593150-32593172 TGACACTTTTACAGTTATCTTGG + Exonic
908306817 1:62827201-62827223 AGATACGATTATAGTTATAGGGG - Intronic
908534225 1:65063981-65064003 TGATAATATTTTAGATATATTGG - Intergenic
908577982 1:65481521-65481543 TGATACAACTAAAGTAATATAGG - Intronic
909121046 1:71604040-71604062 TCATACTATCAGAGATACATGGG + Intronic
909274827 1:73669956-73669978 TGATATTATAAGAATTATAAAGG + Intergenic
911736656 1:101343760-101343782 TGAAGCTATTAGAGTTATTAAGG + Intergenic
912236384 1:107855704-107855726 TCATACTATTAGATTTATTGTGG - Intronic
912662839 1:111549163-111549185 TGTTAGTATTAGGGTAATATTGG + Intronic
912669752 1:111614703-111614725 TGTTACTGTTAGAGTTAGACAGG + Intronic
916147851 1:161757256-161757278 TGAAACTATTATATTTAAATGGG + Intergenic
917461122 1:175230270-175230292 TGATACTGTTAATGTTTTATAGG + Intergenic
918723390 1:187884356-187884378 TGATAATTTTAGAGGGATATTGG + Intergenic
918828503 1:189358744-189358766 AGATACTATTTTAGTCATATTGG - Intergenic
918893175 1:190302329-190302351 TGATACATTTAGAGTTATAGAGG - Intronic
919336453 1:196242846-196242868 TGATATGTTTAAAGTTATATAGG - Intronic
919675123 1:200374585-200374607 TAATTTTGTTAGAGTTATATAGG - Intergenic
922509158 1:226149084-226149106 TGATAGTTTTGGGGTTATATTGG - Intronic
924291294 1:242539155-242539177 TGATATTATTAGAACAATATAGG + Intergenic
1063029473 10:2218458-2218480 TGATACAATAAGAGATATACTGG - Intergenic
1063700874 10:8384266-8384288 TGATACTATTCTAGTTAAATAGG - Intergenic
1066482845 10:35813518-35813540 AGATAATATTTGAGTTATGTGGG + Intergenic
1066592508 10:37010760-37010782 TCATGCTTTTAGAGTTATTTTGG - Intergenic
1067689541 10:48492914-48492936 TGCTACTATTGTAGATATATTGG - Intronic
1068022306 10:51600590-51600612 TGATAATATTTGGGATATATTGG - Intronic
1069645110 10:69990619-69990641 TAATGGTATTACAGTTATATAGG + Intergenic
1071580470 10:86764891-86764913 TGATACTGTTAGGGATACATTGG + Intronic
1074033183 10:109709652-109709674 TGTTACTATTATAGTTGTCTTGG - Intergenic
1074959253 10:118425209-118425231 TAATACTATTGGTCTTATATGGG - Intergenic
1075961450 10:126570879-126570901 TGAAACTATTTGAGTCATAATGG + Intronic
1078114677 11:8434392-8434414 AGAAATTATTAGAGATATATGGG - Intronic
1078416058 11:11165899-11165921 TTATAATATTGGAGTTATCTGGG - Intergenic
1078630927 11:13003565-13003587 TGATACTATTTTGGATATATTGG - Intergenic
1078995888 11:16698859-16698881 TGTTACTATTATAATTATTTTGG - Intronic
1079785516 11:24666427-24666449 TTATACTATATGATTTATATTGG + Intronic
1081331288 11:41803666-41803688 TGATAGAATTAATGTTATATTGG + Intergenic
1081719567 11:45278068-45278090 TGGAACTAATAGAGTTATAAAGG - Intronic
1082792564 11:57356845-57356867 TGATGCAATTAGAGTGATCTTGG + Intronic
1085367182 11:75960008-75960030 TGTTGCTATTATAGTTATTTTGG - Intronic
1088111040 11:106261734-106261756 TTATACAACTAGAGTTTTATGGG + Intergenic
1088851846 11:113710903-113710925 TTATACTATTAAAATTAAATTGG + Intergenic
1089889475 11:121866231-121866253 TGATAATATTTTAGTTATGTTGG - Intergenic
1089998485 11:122931326-122931348 TGATAGTATTAAAGATATATAGG + Intronic
1090595169 11:128313275-128313297 TGATAGTATTTTAGATATATTGG + Intergenic
1093153499 12:15652083-15652105 TAAATCTATTAGATTTATATAGG - Intronic
1093837091 12:23845877-23845899 TTATACTCTTAAAGTTAAATTGG - Intronic
1093917154 12:24817058-24817080 TGATTGTATTAGAATTATCTTGG - Intronic
1095662557 12:44754623-44754645 TAATATGATTAGAGGTATATTGG + Intronic
1096261500 12:50095201-50095223 TGCTACTATTATTGTTATCTGGG + Intronic
1096270286 12:50160627-50160649 TGATACCATCAGATCTATATAGG - Intronic
1097496504 12:60344928-60344950 TTATACAGTTAGAATTATATTGG + Intergenic
1097761505 12:63470974-63470996 TGATAGTATTTTAGATATATTGG - Intergenic
1098007044 12:66008407-66008429 TGATACAATGAGAGATAAATAGG + Intergenic
1103298814 12:119911084-119911106 TGATAATATTTTGGTTATATTGG - Intergenic
1105930599 13:25048358-25048380 TTATAGTATTAGACTTAGATGGG + Intergenic
1109232363 13:59774072-59774094 TTTTACTATTTTAGTTATATTGG + Intronic
1109619500 13:64883624-64883646 TAAAAGTATTATAGTTATATGGG - Intergenic
1109818589 13:67621539-67621561 AAACACTATTACAGTTATATTGG + Intergenic
1109870401 13:68324860-68324882 TGATACCATTATAATTATATTGG - Intergenic
1111779978 13:92710154-92710176 TAATCCTATCATAGTTATATAGG + Intronic
1112791537 13:103007914-103007936 TAATAATATTAGAGTAATATTGG + Intergenic
1115069015 14:29298402-29298424 TAATAAAATTAGAGTCATATTGG - Intergenic
1116303768 14:43221424-43221446 TGATGCTATCAGATTCATATAGG + Intergenic
1116330445 14:43590718-43590740 TGAAACTATGACAGATATATAGG + Intergenic
1117098199 14:52318421-52318443 TGATAATATTTTAGATATATTGG - Intronic
1119081696 14:71700693-71700715 TGATATAATAAGAGTTTTATTGG + Intronic
1119331294 14:73796017-73796039 TGATTCTAAAAGAGTGATATGGG - Intergenic
1125241040 15:37576098-37576120 TGTTACTTTTAGAATTAAATCGG - Intergenic
1126616830 15:50591439-50591461 TTAGGCTATAAGAGTTATATTGG - Intronic
1127738570 15:61872834-61872856 TAATACTTTTAAAATTATATAGG - Intronic
1129668696 15:77594622-77594644 TGATAATATTATAGATATATTGG + Intergenic
1130333111 15:82936462-82936484 TGATACTATTTTTGGTATATTGG + Intronic
1130885124 15:88086448-88086470 TGATAGTATTTTAGATATATTGG + Intronic
1134086675 16:11362133-11362155 TGATACTATTAGAGTTATATGGG + Intronic
1135715094 16:24757314-24757336 TTATACTATTATAGATATATGGG - Intronic
1137464267 16:48693851-48693873 TGCTACTATAGGAATTATATAGG - Intergenic
1139013355 16:62660111-62660133 TGGTACCATCAGAGTGATATTGG + Intergenic
1139208517 16:65052972-65052994 TGATACTATTACAGGAATGTGGG + Intronic
1141230624 16:82163818-82163840 TGTTACTATCAGAGATATGTGGG + Intronic
1143063853 17:4227218-4227240 TTTTACTATTAGGGTTATATAGG - Intronic
1145223792 17:21110758-21110780 TGATATTATTTGATTTATCTGGG - Intergenic
1146042275 17:29467716-29467738 CAGTACTATTAGAGTTAAATGGG - Intronic
1147695905 17:42352961-42352983 TGATAATATTTTAGATATATTGG + Intronic
1149082187 17:52671650-52671672 TTATGCTATTATAGTTATTTGGG - Intergenic
1153491257 18:5650500-5650522 TATTACTATTAGAATTATTTTGG + Intergenic
1153922877 18:9806666-9806688 TGAAACAATTGGATTTATATAGG + Intronic
1156629165 18:38945867-38945889 TGATACTGTTATAATTATTTTGG + Intergenic
1157319852 18:46625680-46625702 TGATAGTATCAGACTTACATTGG - Intronic
1158913623 18:62096473-62096495 TAATATTATTATAGTTATCTGGG - Intronic
1159618393 18:70608845-70608867 ATATAATATTTGAGTTATATGGG + Intergenic
925524986 2:4789787-4789809 AGAAACTGTTAGAGTTATAGTGG + Intergenic
926306537 2:11641050-11641072 TGATCCTATTAAAATAATATAGG + Exonic
930432129 2:51291774-51291796 TGATAATATTTGTGTTTTATAGG + Intergenic
930728097 2:54701082-54701104 TTCTAGTATTAGAGTAATATTGG - Intergenic
930927946 2:56843507-56843529 TGATACTATTCCACTGATATAGG + Intergenic
932841484 2:75087148-75087170 TGATACTACTATGGATATATAGG + Intronic
933393291 2:81700411-81700433 TGGTTATATTACAGTTATATAGG + Intergenic
933906247 2:86896438-86896460 TGTTACTATTAGAATTCTTTTGG + Intergenic
935671887 2:105562968-105562990 TGATATTGTAAGAGTTATATAGG - Intergenic
938729577 2:134136102-134136124 TGAAAATATTAGATTTCTATTGG - Intronic
940646962 2:156401769-156401791 TCATACTATTAGAGTTAAAAGGG - Intergenic
940879535 2:158932929-158932951 TTATAATAATAGAATTATATGGG - Intergenic
941133267 2:161681049-161681071 TGATATTCTTTGAGTTACATTGG - Intronic
941220071 2:162767305-162767327 TGAAAATTTTAAAGTTATATCGG + Intronic
942691931 2:178594789-178594811 TAAAACTATTAGAGTTAAAAAGG + Intronic
944100799 2:196024019-196024041 TGTTACTATTATAATTATCTTGG - Intronic
944272856 2:197803499-197803521 TCATAATTTTAGAGATATATGGG - Intergenic
944450274 2:199835376-199835398 TGTGACTATTAAAGTTACATAGG - Intronic
944541602 2:200758743-200758765 TGATATTAATACATTTATATGGG + Intergenic
945282805 2:208052020-208052042 TAAAAATATTATAGTTATATGGG - Intergenic
947157125 2:227173733-227173755 TGATAATATTACAGATGTATTGG - Intronic
1170137195 20:13087584-13087606 AGGTACTTGTAGAGTTATATGGG - Intronic
1172132816 20:32666967-32666989 TGATAATATTTTAGTTACATTGG - Intergenic
1172597531 20:36160057-36160079 TGATACAATTAATGTTAAATGGG + Intronic
1175397608 20:58677591-58677613 TGACACTAGTAGAGTTTTAATGG + Exonic
1178127559 21:29531762-29531784 TGATAATATTAGAATTAAATAGG - Intronic
1178198231 21:30373100-30373122 TTGAAGTATTAGAGTTATATGGG + Intronic
1182714944 22:32350494-32350516 TAATACAATTTGAGATATATAGG - Intergenic
949861670 3:8510779-8510801 TGATACTATCTCAGTAATATTGG + Intronic
949891292 3:8735264-8735286 TAATACTATTTTAGATATATAGG - Intronic
950315018 3:11994383-11994405 TGTTACTATTACAGTTGTTTTGG - Intergenic
950793068 3:15488733-15488755 TGATAATATTTGAGTTTTGTTGG - Intronic
950957237 3:17067239-17067261 TCTTACTATTAGAGTTATATTGG + Intronic
951007085 3:17630464-17630486 TGTTACTATTATAATTATGTTGG + Intronic
951176346 3:19605313-19605335 TGTTACTATTGGAATTATTTTGG - Intergenic
951844258 3:27068779-27068801 AGAGTCTATTAGAGTTACATAGG + Intergenic
953048701 3:39320510-39320532 TTAGAATATCAGAGTTATATAGG + Intergenic
956750799 3:72342404-72342426 TGATTCTCTTAGAGTTATGGAGG + Intergenic
958129888 3:89405041-89405063 TGAAACTATAAGAGCTTTATAGG + Intronic
958599360 3:96275284-96275306 TGATACTATTTGGGATATACTGG - Intergenic
959329867 3:104990578-104990600 TGAAACTATTAGCTTTATATGGG - Intergenic
959905502 3:111706942-111706964 AAATATTATTAGAGTTAAATAGG + Intronic
966087590 3:176087646-176087668 TGATACTATTATAATTGTCTTGG - Intergenic
966795897 3:183713195-183713217 TGATAATATTTTAGATATATTGG + Intronic
967461703 3:189755338-189755360 TGATACTTCTAAAGTTATGTTGG - Intronic
969933806 4:10660927-10660949 TGATGCTATCAAAGTCATATAGG - Intronic
971483483 4:27135356-27135378 CTATACTATTAAAGTTAAATTGG + Intergenic
971715936 4:30176961-30176983 AGATTCTATTAGAATTATACAGG + Intergenic
971721616 4:30252249-30252271 TGATACCATAACAGATATATAGG - Intergenic
972189361 4:36571269-36571291 TGATACTATTTTAATTATTTAGG - Intergenic
974196959 4:58587530-58587552 AGATACTTTTAAAGTTATTTAGG + Intergenic
975608703 4:76182386-76182408 TGATGCTATTTCAGTTATAATGG + Intronic
975912701 4:79286787-79286809 TGAGACTGTTAGAATTATTTTGG + Intronic
978416566 4:108483016-108483038 TGGTAATATTAGAGATATGTTGG + Intergenic
979839907 4:125424559-125424581 TGAGACTATTATACTTCTATGGG + Intronic
980544117 4:134235027-134235049 TAAAAGTATTAGAGTTATAAAGG + Intergenic
981018389 4:139999678-139999700 TGACACTATACAAGTTATATTGG - Intronic
982085125 4:151827374-151827396 TGTTACTATTATAATTATATTGG - Intergenic
983016923 4:162624887-162624909 TGATGTTATTAAAATTATATGGG + Intergenic
984741108 4:183164024-183164046 TGGTACTATTAGAGTTTTTGAGG + Intronic
984959559 4:185082576-185082598 TGATACTGGTAGGGTTAAATGGG - Intergenic
986886752 5:12247407-12247429 TTCTAGTATTAGATTTATATTGG + Intergenic
988134163 5:27147741-27147763 TGATGCTATTAGAATGATATAGG + Intergenic
988143849 5:27278186-27278208 TCAGACTATTAGTGTTATAAAGG - Intergenic
990073891 5:51818961-51818983 TGATATTCTTTGAGTTTTATTGG + Intergenic
990462852 5:56045927-56045949 AGATACTTTGGGAGTTATATTGG + Intergenic
991361133 5:65821497-65821519 TGATACTATTGTAGATATAGTGG + Intronic
991471443 5:66973191-66973213 TAATAATAATATAGTTATATAGG - Intronic
993294971 5:86125592-86125614 AAATACTATTACAGTTATTTTGG + Intergenic
993444915 5:87999505-87999527 TGATACGATTACAGTTCTTTTGG - Intergenic
994768007 5:103945514-103945536 GGAAACTATTAGGGTTATAGGGG - Intergenic
998027678 5:138833456-138833478 TGATATTATTTTAGATATATTGG + Intronic
998921540 5:147073733-147073755 TCAAACTATTAGAATTATTTGGG + Intronic
999817736 5:155194457-155194479 TGTTATTATTAGAGGAATATTGG + Intergenic
999882655 5:155883599-155883621 TGTTACTATTATAATTATATTGG - Intronic
1002586150 5:180249758-180249780 TGATAATATTATGGATATATTGG - Intronic
1004269670 6:14183430-14183452 TGAAACTTTTATAGTTCTATTGG + Intergenic
1004769574 6:18766818-18766840 TGATAATATTTTAGATATATTGG + Intergenic
1004922348 6:20387772-20387794 TAATATTAATAGAGTTTTATTGG - Intergenic
1004937487 6:20522110-20522132 TGATACAATCAAAATTATATTGG - Intergenic
1005788128 6:29268134-29268156 GGAGACTATTAGAGTTAAATTGG + Intergenic
1005845426 6:29773231-29773253 TGATAATATTAGCCATATATTGG + Intergenic
1007020056 6:38510959-38510981 CTATACTTTTAGAGTTATTTTGG - Intronic
1008162960 6:48101481-48101503 TGTTCCCATTATAGTTATATTGG - Intergenic
1008626172 6:53318851-53318873 TGATAATATTTTAGATATATTGG - Intronic
1009601886 6:65811705-65811727 TAACATTATTAAAGTTATATAGG - Intergenic
1009875017 6:69495022-69495044 TTATACTATTAGAGTATTCTAGG - Intergenic
1009900359 6:69801564-69801586 TGATAATATTTGGGATATATTGG + Intergenic
1010255867 6:73757739-73757761 AGATACTATTTTAGATATATAGG + Intronic
1012211909 6:96529985-96530007 TGACTGTATTATAGTTATATAGG - Intronic
1012438129 6:99236671-99236693 TGATACAATTTGAGTTCAATTGG - Intergenic
1016110272 6:140214621-140214643 TGAAAGTATTATAGATATATGGG + Intergenic
1017292580 6:152757744-152757766 GAATGCTATTAGAGTCATATAGG - Intronic
1018149179 6:160922480-160922502 TGTTATTATTACAGTTATGTTGG - Intergenic
1020407186 7:7850204-7850226 TGTAACTATTAAAGTTATAAAGG - Intronic
1021848746 7:24787639-24787661 TGATACTATTACTGTTGTAATGG - Intergenic
1022958839 7:35405826-35405848 TGTTACTATTATAATTATTTTGG + Intergenic
1024008797 7:45250240-45250262 TGATACATTTTGAGTTATTTTGG - Intergenic
1024126239 7:46298826-46298848 TTTTACTATTAGAGTGATACTGG - Intergenic
1026415332 7:70173786-70173808 TGTTACTATTTTAGTTATTTTGG + Intronic
1028293950 7:89104219-89104241 TTTTACTATTAGGGTTATACTGG + Intronic
1030546047 7:110896764-110896786 TGCTAGTATGATAGTTATATAGG + Intronic
1030577532 7:111308604-111308626 TGATACCATTAAAGTAAGATTGG - Intronic
1030709012 7:112727621-112727643 TGATACTATTAGAGATAAAAAGG - Intergenic
1033162196 7:139007575-139007597 TGATACTAACAGACTTATCTTGG + Intergenic
1033332021 7:140424715-140424737 TGAAACAATTATAGATATATGGG - Intronic
1034347072 7:150393068-150393090 TGATACTATAATAGTGATACGGG - Intronic
1035816587 8:2547715-2547737 TGATTTTAATAGAGTTATTTAGG + Intergenic
1039735474 8:40327635-40327657 TGATAATATTTGGGATATATTGG + Intergenic
1043252618 8:78094326-78094348 TGAAACAATTAAAATTATATTGG - Intergenic
1043267613 8:78286403-78286425 AGTTACTATTTGAGGTATATTGG - Intergenic
1043741668 8:83821371-83821393 TGATACTTTTAGAGTTCAAATGG - Intergenic
1045454733 8:102366610-102366632 TGATCTTTTAAGAGTTATATGGG - Intronic
1045722107 8:105124734-105124756 TGATATTATTATAGTTGTTTTGG - Intronic
1046914319 8:119663540-119663562 TGAAACTATAAGAGATCTATAGG - Intronic
1047979583 8:130166581-130166603 GGATACTATTAGAGATACATTGG - Intronic
1048159156 8:131996004-131996026 TGAAAATATTAGAGATATAAGGG + Intronic
1050352008 9:4749147-4749169 TGAAAATATTAGAGTTGTTTTGG + Intergenic
1050558695 9:6811565-6811587 TTTTTATATTAGAGTTATATCGG - Intronic
1051015655 9:12472842-12472864 TGATAATATTTTAGATATATGGG - Intergenic
1051248186 9:15133203-15133225 TGAGACTATTATAGTCATTTTGG - Intergenic
1052683818 9:31728900-31728922 TTTAACTATTAGAGCTATATTGG - Intergenic
1053568918 9:39284076-39284098 TGATCATATTATGGTTATATAGG - Intronic
1053834887 9:42125111-42125133 TGATCATATTATGGTTATATAGG - Intronic
1054090552 9:60843041-60843063 TGATCATATTATGGTTATATAGG - Intergenic
1054111963 9:61118598-61118620 TGATCATATTATGGTTATATAGG - Intergenic
1054128226 9:61334932-61334954 TGATCATATTATGGTTATATAGG + Intergenic
1054595650 9:67062418-67062440 TGATCATATTATGGTTATATAGG + Intergenic
1057691331 9:97289264-97289286 TGATAATATTTGAGATATATTGG - Intergenic
1058999973 9:110338365-110338387 AGATACTATTTTAGTTTTATGGG + Intergenic
1059239819 9:112794611-112794633 TGATTCTATTGGAGGAATATGGG - Intronic
1059945074 9:119401223-119401245 TGATACTATTTTGGATATATTGG - Intergenic
1060532686 9:124357329-124357351 TGTTGCTAATAGAGTTTTATTGG - Intronic
1186050574 X:5590460-5590482 TCATACTAGTATTGTTATATTGG - Intergenic
1187300737 X:18046997-18047019 TGATACTATTTTAGATCTATTGG - Intergenic
1187354158 X:18551369-18551391 TGATACTATAATAGTTACAATGG + Intronic
1191869321 X:65732348-65732370 TGATAATATTTTAGATATATTGG + Intronic
1194286476 X:92017142-92017164 TGTTACTATTATAATTATTTGGG - Intronic
1195837616 X:109135561-109135583 TAATACCATAAGAGCTATATAGG + Intergenic
1196222683 X:113129929-113129951 TGAGAGTATAAGTGTTATATTGG + Intergenic
1196367191 X:114936593-114936615 TGACAGTATAAGAGATATATAGG - Intergenic
1200604020 Y:5241693-5241715 TGTTACTATTATAATTATTTGGG - Intronic