ID: 1134088124

View in Genome Browser
Species Human (GRCh38)
Location 16:11372515-11372537
Sequence GGGACATGAAACTCTCCCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134088124_1134088130 1 Left 1134088124 16:11372515-11372537 CCAGTGGGAGAGTTTCATGTCCC 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1134088130 16:11372539-11372561 CGGAAGTATTTTGAGCCCAGTGG 0: 1
1: 0
2: 0
3: 8
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134088124 Original CRISPR GGGACATGAAACTCTCCCAC TGG (reversed) Exonic
900330672 1:2133035-2133057 GGGTGAACAAACTCTCCCACAGG - Intronic
902890199 1:19437770-19437792 GTGTCATGAAGTTCTCCCACTGG - Intronic
903118657 1:21198792-21198814 GGGGCAAGAAACTCTCACATAGG + Intergenic
904537268 1:31208072-31208094 GGAACTGGAAACTCTCCCAATGG + Intronic
906001435 1:42429610-42429632 GGAACATAAAACTCTCTGACAGG + Intergenic
906364099 1:45190889-45190911 CGAACATGGAACTCTCCGACAGG - Intronic
910506153 1:87952055-87952077 GGAGCATGTAACTCTCACACAGG + Intergenic
1070051437 10:72893853-72893875 TTGACATGAGACTCACCCACGGG - Exonic
1070307677 10:75249202-75249224 GGCACATGGAATTCTGCCACTGG + Intergenic
1071070569 10:81687799-81687821 GGGAAAAGAATCTCTCACACAGG - Intergenic
1072152890 10:92697172-92697194 GGGAAGGGAAACTCTCCCACTGG - Intergenic
1074187725 10:111111670-111111692 GACACATGAGGCTCTCCCACTGG - Intergenic
1076320204 10:129574135-129574157 AGCACATGAAACTCTCCAAAGGG - Intronic
1080552363 11:33383655-33383677 AGGACAAGAAACTCTCACTCGGG + Intergenic
1088183609 11:107139473-107139495 GGGACATGAAGCTGTTCCAGGGG - Intergenic
1090752491 11:129759744-129759766 AGCACATGAAACACCCCCACAGG + Intergenic
1095160814 12:38912912-38912934 GGGACTTGACACTTTCCAACAGG + Intergenic
1101993975 12:109511561-109511583 GGGACAGGAAAGGGTCCCACGGG + Intronic
1106415672 13:29543874-29543896 AGGACATGAGGCTCTACCACAGG + Intronic
1106936950 13:34733151-34733173 TGGACATGAATGTCTCCAACAGG + Intergenic
1108496722 13:51032973-51032995 GGCCCATGAGACTGTCCCACTGG - Intergenic
1119174880 14:72561747-72561769 GGGTCATCAAACTCTGCCTCTGG + Intronic
1121576521 14:94993238-94993260 GGAAAGTGAAACTCTGCCACAGG + Intergenic
1125326286 15:38538923-38538945 GGCACATGAAACCCTCACCCTGG + Intronic
1125484041 15:40100176-40100198 GGGACAGAAGACTCTCCCAAGGG + Intronic
1129964288 15:79720109-79720131 GGGAGATGAAGCGCTCCCAGTGG - Intergenic
1132407092 15:101549814-101549836 GGGACATGAAGATCTGCCTCTGG - Intergenic
1134088124 16:11372515-11372537 GGGACATGAAACTCTCCCACTGG - Exonic
1137890442 16:52155788-52155810 GGGATATGAAACCATTCCACTGG - Intergenic
1144042015 17:11420468-11420490 GGAACAAAAAACTCTACCACTGG - Intronic
1144699151 17:17325451-17325473 GGGACATGGGACTCACCAACAGG - Intronic
1156354895 18:36332399-36332421 GAGACATGATTCTCTCTCACAGG + Intronic
1157909482 18:51602107-51602129 GTGACATGCACCCCTCCCACAGG + Intergenic
1161248451 19:3267921-3267943 GGGAGGTGAAACTGTCACACTGG - Intronic
1164117684 19:22237964-22237986 AGGAGATGAGACTCTCACACAGG + Intergenic
1164384959 19:27764489-27764511 GGGCCAGGAGTCTCTCCCACTGG + Intergenic
1165004644 19:32794942-32794964 GGGAAAGGACACTTTCCCACAGG - Intronic
1167320524 19:48794918-48794940 GAGACATGAAATGCTCCCCCAGG + Intergenic
1168293806 19:55369469-55369491 GAGACACGGACCTCTCCCACGGG + Intronic
927289605 2:21392823-21392845 GGGTCATTACACTCTCCCATGGG + Intergenic
931627105 2:64266667-64266689 AGGGCTGGAAACTCTCCCACAGG + Intergenic
937399631 2:121570920-121570942 GAGAAATGAAAGTCACCCACGGG + Intronic
939677905 2:145095317-145095339 GGGTCAAGAATATCTCCCACTGG - Intergenic
944631210 2:201626716-201626738 GGGATATGAAACTCCCTGACAGG + Intronic
1169359404 20:4935441-4935463 AGGATATGAAACTCTACCGCAGG + Intronic
1175379514 20:58553147-58553169 GGGACATGAATCTGCCTCACAGG - Intergenic
1175877111 20:62235584-62235606 GGGTCATGAAATCCACCCACTGG + Intronic
1178147285 21:29754804-29754826 GGGACAGGAAATTCTCCCTGTGG + Intronic
1181015202 22:20064604-20064626 TGGACAAGGACCTCTCCCACTGG + Exonic
1184630487 22:45774396-45774418 GAGACCTGGAGCTCTCCCACAGG - Intronic
949854485 3:8448777-8448799 GGCAAATGAAACACTTCCACGGG + Intergenic
950626250 3:14249240-14249262 AGGACATGAAATTCTCCTGCAGG + Intergenic
950682123 3:14592627-14592649 GTGACATCAAACACTCCCGCCGG - Intergenic
951497031 3:23340953-23340975 GGAATCTAAAACTCTCCCACTGG - Intronic
958779997 3:98529841-98529863 GGGACAGAAATCTTTCCCACTGG - Intronic
959099666 3:101996092-101996114 GGGAAATGAAAATTTCCAACTGG + Intergenic
968086077 3:195874522-195874544 GGCACAAGAAACTCCCCCTCGGG + Intronic
968086119 3:195874700-195874722 GGCACAAGAAACTCTCCCTCGGG + Intronic
968086160 3:195874877-195874899 GGCACAAGAAACTCCCCCTCGGG + Intronic
968086191 3:195875010-195875032 GGCACAAGAAACTCCCCCTCGGG + Intronic
968086234 3:195875188-195875210 GGCACAAGAAACTCCCCCTCGGG + Intronic
968086266 3:195875321-195875343 GGCACAAGAAACTCCCCCTCGGG + Intronic
968086277 3:195875366-195875388 GGCACAAGAAACTCCCCCTCGGG + Intronic
968410266 4:384388-384410 GGGAGATGAAAAACACCCACGGG + Intronic
978742764 4:112156273-112156295 GGGATATGAAGCTCTGCCAAGGG - Intronic
979483840 4:121248387-121248409 GCGACCTGAAAATTTCCCACTGG + Intergenic
980601787 4:135036614-135036636 GGGAGATAAAACTCTCACAAAGG - Intergenic
983452744 4:167928050-167928072 GGAACCTTAATCTCTCCCACTGG - Intergenic
984625551 4:182003838-182003860 GGAACATGAAACTTACACACAGG - Intergenic
988306843 5:29503880-29503902 GGGACATAAAACTATTCCAGAGG + Intergenic
990037857 5:51344583-51344605 GCAACATGAAACTCTCCCAGCGG - Intergenic
990561040 5:56983079-56983101 GGGCCATGAATCTGTCCCATTGG + Intergenic
993796032 5:92268491-92268513 GGGACAGGAGGGTCTCCCACTGG - Intergenic
994093936 5:95832056-95832078 GGGACATGTGAGTCTCCCATGGG + Intergenic
995462118 5:112414516-112414538 GGGACAGGATAAACTCCCACAGG + Intronic
997469299 5:134108000-134108022 GGGACAGGAGACTCACTCACAGG + Intergenic
999492536 5:152065289-152065311 GGGCCAAGATAATCTCCCACAGG - Intergenic
1000493516 5:161947139-161947161 GTGACCTGAAAACCTCCCACTGG + Intergenic
1001804418 5:174571032-174571054 GGGCAATGAAAGTCCCCCACTGG - Intergenic
1003966678 6:11258684-11258706 GGGTCATTAAACTCCCCCAGAGG + Intronic
1008289326 6:49694369-49694391 GGGACTTGAGTCTGTCCCACTGG + Intronic
1011651310 6:89509002-89509024 GGGCCATGAAGCTCTTGCACAGG + Intronic
1012020652 6:93914768-93914790 GCAACATGAATCTCTTCCACTGG - Intergenic
1019024079 6:168942733-168942755 GGGCCATGAATCTGACCCACAGG - Intergenic
1022041772 7:26588237-26588259 GGGACAGGGAACCATCCCACAGG - Intergenic
1024141896 7:46470189-46470211 GTGCCATGAAAGTCTCTCACTGG + Intergenic
1024215950 7:47248154-47248176 GGCCCATGAAACTGCCCCACAGG + Intergenic
1031201804 7:118697965-118697987 GGCACAGGAAAATCTCTCACTGG - Intergenic
1031901622 7:127417643-127417665 GGGCCAAGATACTATCCCACAGG + Intronic
1038060848 8:23910612-23910634 GTGACATCAAACTCTACCAGTGG - Intergenic
1041425802 8:57719029-57719051 AGGACATGTAACCCTTCCACAGG + Intergenic
1054162355 9:61682665-61682687 ACGACTTGAAACACTCCCACAGG + Intergenic
1055728378 9:79256304-79256326 GGGACATGAACGGCACCCACAGG - Intergenic
1057913341 9:99036800-99036822 GGAACATGTGGCTCTCCCACTGG - Intronic
1060112534 9:120916911-120916933 GGGACCTGAAAGGCTCCCCCAGG - Intronic
1060549789 9:124479496-124479518 GGGACATCATACTCACCCAGCGG + Intergenic
1060787142 9:126459782-126459804 TGGACCTGCCACTCTCCCACAGG + Intronic
1189679438 X:43500140-43500162 GGGACAGGAAACTTGCACACTGG + Intergenic
1190411581 X:50141617-50141639 GGGAGAGGAAACAATCCCACAGG - Intergenic
1192437644 X:71152885-71152907 GGGAGATGAAGCTTTCCCTCTGG - Intronic
1194491452 X:94555084-94555106 AGGACATAAAACTCTCACTCAGG - Intergenic
1196386521 X:115159956-115159978 GGTACATGAAACTATCCTAGGGG - Intronic
1196886132 X:120247508-120247530 GGGATATATAACTCTCCTACTGG - Intergenic
1197460341 X:126733744-126733766 GTGATATGACACTATCCCACAGG - Intergenic
1197845915 X:130802626-130802648 GGGAGACCAAACTCTGCCACTGG - Intronic
1198268272 X:135031258-135031280 CTGACAAGAAACCCTCCCACAGG + Intergenic
1199076557 X:143532645-143532667 GGGAAATGAAACTTAGCCACTGG + Intergenic
1199418654 X:147617334-147617356 TGAACTTGAAACTCTCCAACTGG + Intergenic
1200925723 Y:8652803-8652825 GGGGCAAGAAACTCTCTCTCAGG + Intergenic
1201529979 Y:14980825-14980847 GGGAGATAAGACTCTCACACAGG + Intergenic