ID: 1134088850

View in Genome Browser
Species Human (GRCh38)
Location 16:11378927-11378949
Sequence TTCCTTCTTGATCTTCTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134088849_1134088850 11 Left 1134088849 16:11378893-11378915 CCAACTGGTCTATAGTATTGTTC No data
Right 1134088850 16:11378927-11378949 TTCCTTCTTGATCTTCTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134088850 Original CRISPR TTCCTTCTTGATCTTCTGTC TGG Intronic
No off target data available for this crispr