ID: 1134089388

View in Genome Browser
Species Human (GRCh38)
Location 16:11383588-11383610
Sequence CCTGGAAGGCAGATGCCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 410}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134089379_1134089388 12 Left 1134089379 16:11383553-11383575 CCCTGGTGAGAGAAAGGGACTGG 0: 1
1: 0
2: 0
3: 32
4: 348
Right 1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG 0: 1
1: 0
2: 4
3: 38
4: 410
1134089378_1134089388 15 Left 1134089378 16:11383550-11383572 CCTCCCTGGTGAGAGAAAGGGAC 0: 1
1: 0
2: 0
3: 40
4: 838
Right 1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG 0: 1
1: 0
2: 4
3: 38
4: 410
1134089381_1134089388 11 Left 1134089381 16:11383554-11383576 CCTGGTGAGAGAAAGGGACTGGT 0: 1
1: 0
2: 0
3: 28
4: 214
Right 1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG 0: 1
1: 0
2: 4
3: 38
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134089388 Original CRISPR CCTGGAAGGCAGATGCCAGA CGG Intronic
900208062 1:1439951-1439973 CCTGGAGGGCAGGCGCCAGGCGG - Exonic
900286225 1:1901870-1901892 ACTGACAGGCAGATGCCAGCAGG + Intergenic
900605663 1:3522535-3522557 CCTGGGAGGCAAATCCCAGAAGG + Intronic
900935802 1:5765715-5765737 CCTGGAGGGCTGCTGCCAGGGGG - Intergenic
900979980 1:6040756-6040778 CGTGGAAGGCAGAAGCCTGTGGG - Intronic
900992037 1:6102538-6102560 CATGGGAGCCAGAAGCCAGATGG - Exonic
901175417 1:7295173-7295195 CCAGGGAGGCAGATGCCATTAGG - Intronic
901755757 1:11440507-11440529 CCTGGGAGGCAGGTGCCACTTGG + Intergenic
902645968 1:17798135-17798157 CCTAGAAGGCAGAGGTCATATGG + Intronic
903369901 1:22828473-22828495 TCTGGCAGGAAGAGGCCAGAGGG + Intronic
903553668 1:24177538-24177560 GCTGGAAAGCAGGTGGCAGATGG - Intronic
903938646 1:26913695-26913717 CTGGGGAGGCAGCTGCCAGAAGG + Exonic
904492967 1:30871634-30871656 CCTGCCAGGCAGAGGGCAGAGGG + Intronic
904624474 1:31794235-31794257 CCTGGGAGGCAGAAGACAGAGGG + Exonic
904860328 1:33533075-33533097 CCTGCAAGGCGGATGGCAGCTGG - Exonic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
906670592 1:47651439-47651461 CAAGGAAAGCAGAGGCCAGAGGG + Intergenic
907120999 1:52007816-52007838 CTTGGAAGTTAGATGCAAGAGGG + Intergenic
907257312 1:53189703-53189725 CCAGGTAGGCAGAAGCAAGAAGG + Intergenic
908658686 1:66415309-66415331 ACTGGAAGGACGATGCTAGATGG - Intergenic
911710946 1:101072258-101072280 TCTGGAGGGCAGGTTCCAGAAGG + Intergenic
911931371 1:103908315-103908337 CATGAAAGGCAGCTGCGAGAAGG + Intergenic
912013167 1:104997114-104997136 CATTGAAGGCAGAAGACAGAAGG + Intergenic
912572165 1:110632741-110632763 CCTGGAGGGCAGAAGTAAGAAGG + Intergenic
914881453 1:151550105-151550127 CCTGGGAGGCAGAGGCCCCAGGG - Intronic
914979341 1:152398959-152398981 GCTGGAAGACAGTTGCCAGTAGG + Intergenic
916637999 1:166694800-166694822 CCATGAAGGCAGAAGTCAGATGG - Intergenic
918009329 1:180572016-180572038 CCAGGAAGGAAAATGGCAGAAGG + Intergenic
918082823 1:181220844-181220866 GCTGGTAGGCAGGGGCCAGAGGG - Intergenic
918155990 1:181847250-181847272 CCTGTTAGGCAGATGTCATAAGG - Intergenic
918186210 1:182129787-182129809 GCTGGGAGTCAGATGCCAGGTGG + Intergenic
918446713 1:184624191-184624213 TCTGGAAGGCAGATGCCCCCAGG - Exonic
918990910 1:191696136-191696158 CTTGGAAGGTAGAAGCAAGATGG - Intergenic
919793285 1:201305979-201306001 CATGGAAGGGAGATGGCTGAGGG + Intronic
920378942 1:205524617-205524639 ACTGGAAGGCACATGCCAGCTGG - Intronic
924448579 1:244157241-244157263 CCTTGAAGACATTTGCCAGAAGG - Intergenic
1063119552 10:3095619-3095641 CTTGGAAGGCAAATTCCAAAAGG + Intronic
1063944178 10:11161260-11161282 CCTCTAAGACAGATGCCATATGG - Intronic
1063967805 10:11360399-11360421 CCAGGAAGGAAGATGCCCAAAGG - Intergenic
1064493281 10:15883000-15883022 CCAGGAAAGCAGAGGCCAGGAGG + Intergenic
1064873542 10:19966849-19966871 CCTGCAATGCAGAGGCCAGGGGG + Intronic
1065096718 10:22287810-22287832 CTTGGAAGGCTGAAGGCAGAAGG + Intergenic
1065516928 10:26533021-26533043 TCCGGCAGGCAGATGCCACATGG - Intronic
1065520869 10:26570580-26570602 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1066463487 10:35633154-35633176 CCTGGCTGGCAGAGGCCTGAGGG - Intergenic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1067686201 10:48467088-48467110 CCAGGCAGGAAGAGGCCAGAAGG - Intronic
1069321230 10:67173930-67173952 GCTGGAAGGCAAATGACAAAGGG + Intronic
1069679909 10:70277147-70277169 CTGGGGAGGCAGAGGCCAGATGG - Intronic
1069898615 10:71694519-71694541 CCAGGAGGGCAGGTGGCAGAAGG + Intronic
1072749317 10:97965923-97965945 CTTGGAAAGGAGATGACAGATGG + Intronic
1073265768 10:102227604-102227626 CCTGGCAAGCAGAAGGCAGAGGG - Exonic
1073441788 10:103556550-103556572 CCTGGAAGGGAGAAGCCACCTGG - Intronic
1073460937 10:103665589-103665611 CCTAAGAGGCAGCTGCCAGAGGG - Intronic
1075253901 10:120908741-120908763 CCTGGAAGGCAGATGGGAGGGGG + Exonic
1075293569 10:121252494-121252516 CATGGAAGGCAGAGAACAGAAGG - Intergenic
1075861972 10:125684698-125684720 CCTGGAACGCAGATGCCATCTGG - Intergenic
1077669987 11:4148333-4148355 CCTGGGAGGCTGAGGCAAGAGGG - Intergenic
1077698067 11:4413200-4413222 TCTGGAGGGAAGATGACAGAAGG + Intergenic
1077757511 11:5049331-5049353 CCTGCAAGTAAGATTCCAGATGG - Intergenic
1077890036 11:6411938-6411960 ACTGGAAGGCAGGTCACAGAGGG + Intronic
1079383783 11:19960988-19961010 CCTGGAAGACAGAGACCCGAGGG + Intronic
1080856512 11:36116336-36116358 CCAGGAAGCAAGATACCAGATGG - Intronic
1081206747 11:40284280-40284302 CATGGCAGGCAGATGGGAGAGGG + Intronic
1081740647 11:45437445-45437467 CCTGGAAGGAGTGTGCCAGAGGG + Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083678616 11:64341248-64341270 TCTGCAAGGCACATGCCACAAGG - Exonic
1084163879 11:67366162-67366184 CCTGGAAGCCAGATTGCAGGGGG + Intronic
1084387312 11:68852056-68852078 CCTGGAAGGGAAGGGCCAGATGG - Intergenic
1084394147 11:68897894-68897916 CCTGGGAGACAGAAGCTAGAGGG - Intronic
1085457611 11:76674133-76674155 CCTAGAAGGCAGGGCCCAGAAGG - Intergenic
1085526114 11:77165278-77165300 CAAGGACTGCAGATGCCAGAGGG - Intronic
1085741109 11:79079197-79079219 GCTGGCAGGCAGGTGACAGATGG + Intronic
1089271085 11:117301664-117301686 ACTGGAAGGCAGCCACCAGATGG - Intronic
1089958627 11:122596141-122596163 CTTTGAAAGCAGATGACAGAGGG - Intergenic
1090270500 11:125382599-125382621 CATGAAAGGCAAATTCCAGACGG - Intronic
1090404295 11:126467781-126467803 CCTTGAGGCCAGAGGCCAGAGGG + Intronic
1090808360 11:130216929-130216951 CCAGGAAAGCAGCTGCCTGAGGG + Intergenic
1091186203 11:133650063-133650085 CCAGGAAGGCCCCTGCCAGAGGG + Intergenic
1091447825 12:554039-554061 CCTGGAAGGCAGGGGCCTAAGGG + Intronic
1091873749 12:3916835-3916857 TGTGGTGGGCAGATGCCAGAAGG - Intergenic
1092111953 12:5970403-5970425 CCTTGAAGGGAGATGAGAGATGG + Intronic
1092125714 12:6073846-6073868 CCTGGAAGCCTGAAGACAGAGGG - Intronic
1092775657 12:11943299-11943321 CCTTGAAGGCAGAGGCCATGGGG - Intergenic
1092987775 12:13863195-13863217 CCTGGAAGGCAGTAGCCAGTGGG + Intronic
1093706062 12:22276095-22276117 CTTGGTAGGCAGAGGCCTGAGGG - Intronic
1094243983 12:28265508-28265530 CCTGGAAGACAGATGCCTTTTGG + Intronic
1094293413 12:28877206-28877228 GTTTGAAGGCAGAAGCCAGATGG - Intergenic
1094694946 12:32809159-32809181 CCTGGGATGCAGCTCCCAGAAGG - Intronic
1095416583 12:41983611-41983633 CCTGGCAGGCAAATCACAGATGG - Intergenic
1095417275 12:41990579-41990601 CCTGGGAGGCTGAGGCCAGAGGG - Intergenic
1095691673 12:45096282-45096304 CCTGGGAGGCGGAGGCAAGATGG + Intergenic
1096252261 12:50040779-50040801 CCTGGATGGCAGAGGACAGCGGG + Intergenic
1096653173 12:53072248-53072270 CCTGGGACCCTGATGCCAGACGG + Intronic
1097170621 12:57110782-57110804 CCTGGAAGGTTGATGCCAGAGGG - Intronic
1097847643 12:64382928-64382950 CTTGGAAGTTAGAAGCCAGATGG - Intronic
1098996733 12:77129127-77129149 CCTAGAAGGCAGAAGACAGAAGG - Intergenic
1099667790 12:85653829-85653851 CCTGGAATGGAGCTCCCAGAGGG - Intergenic
1100531834 12:95468420-95468442 CCCGCAAGGCAGATTGCAGAGGG - Intergenic
1100881051 12:99017174-99017196 CTTGGAAGTCAGAAGCAAGATGG - Intronic
1102533069 12:113561241-113561263 CCTGGAAGGCACACGCCGGCCGG + Intergenic
1103402140 12:120650311-120650333 CCTGGAGAGCTGATGGCAGAGGG - Intronic
1104197441 12:126554504-126554526 CTTGGAAGTTAGATGCAAGATGG + Intergenic
1104436544 12:128761529-128761551 CCAGGAAGGGAGATTCCAGAGGG - Intergenic
1104932882 12:132348996-132349018 CCTGGAATGCAGCGGGCAGAGGG + Intergenic
1107457076 13:40564858-40564880 CCAGGCATGCAGATGGCAGATGG - Intronic
1108326407 13:49336701-49336723 CCTGGAAGGAAGATGGCAATTGG - Intronic
1108503649 13:51090119-51090141 TCTTGAAGGCAGGTGACAGAAGG + Intergenic
1108584409 13:51856568-51856590 CCTGGAGGTCAGAAGCAAGATGG + Intergenic
1111096634 13:83524006-83524028 TCAGGAAGGCAGAAGGCAGAAGG - Intergenic
1112262956 13:97894501-97894523 CCTGGAATTCCAATGCCAGATGG - Intergenic
1113548866 13:111176396-111176418 AATGGCAGCCAGATGCCAGAGGG - Intronic
1114770212 14:25422155-25422177 CTTCGAAGGCTGAGGCCAGAGGG - Intergenic
1120667321 14:87322131-87322153 CCTGGAATGGAGGAGCCAGAAGG + Intergenic
1120706431 14:87750724-87750746 CCAGGGAGGGAGATGCAAGAAGG + Intergenic
1120838880 14:89065251-89065273 CCTGGATGGGAGATGGCAGCGGG + Intergenic
1121242777 14:92441910-92441932 GCTGGAGGGCAGATGGCAGAGGG + Intronic
1121287147 14:92745053-92745075 TCTGGGAGGCCGAAGCCAGAGGG + Intronic
1121454243 14:94028101-94028123 ACTGGAAGTTAGATGGCAGATGG + Intronic
1121971616 14:98362335-98362357 CCTAGAAGGCAGAGGCCGGTGGG + Intergenic
1122323474 14:100868961-100868983 CCAGGATGACAGAGGCCAGATGG - Intergenic
1122540239 14:102493906-102493928 GTTGGATGGCAGATGCCAGAAGG - Intronic
1122884115 14:104702996-104703018 CCTGGCAGGCAGACGCCAGGGGG - Intronic
1124906263 15:33871490-33871512 CCTGGGAGGCAGAGGCCGCAGGG + Intronic
1125572756 15:40733572-40733594 CCTGGAAGCCAGATGCCAAATGG + Intergenic
1126225268 15:46262415-46262437 CCTGGGACGAAGCTGCCAGAGGG - Intergenic
1126851923 15:52802304-52802326 GCTGGAAAGAAGTTGCCAGAAGG + Intergenic
1126890963 15:53203746-53203768 TCTGGAGGTCAGAGGCCAGAGGG - Intergenic
1127385020 15:58460191-58460213 CCTTAAAGACAGATGCCAGGTGG - Intronic
1127791862 15:62405349-62405371 CCTGCAGGGCAGATGCCTGCTGG + Intronic
1128290818 15:66477036-66477058 CCTGGGAGCCAGATCCCGGAGGG - Intronic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129801760 15:78420228-78420250 CTTGGAAGTCAGAAGCAAGATGG + Intergenic
1130180636 15:81624309-81624331 CTTGGAAGGCTGAGGCGAGAAGG - Intergenic
1130642136 15:85687239-85687261 CCTGGAAGTCAGATAACAGGAGG - Intronic
1131077761 15:89506544-89506566 GCTGGAAGGCAGTTGACAGAAGG - Intergenic
1131262660 15:90895798-90895820 TCTGGAAGGCAGGTCTCAGAAGG + Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1132049332 15:98593922-98593944 CTTGGGAGGCAGAGGGCAGAAGG - Intergenic
1132632862 16:928312-928334 TCTGGAAGGCCAATGCCAGCTGG - Intronic
1132638532 16:966130-966152 CTGGGAAGGCAGAGGCCAGGTGG + Intronic
1133283893 16:4681726-4681748 CCTGGACAGCAGCCGCCAGAAGG + Exonic
1133284403 16:4683911-4683933 CCTGGCAGGTAGATGTCAGCAGG - Exonic
1133675502 16:8067255-8067277 ACTGGAAAACAGATGCCTGAAGG - Intergenic
1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG + Intronic
1135899238 16:26441514-26441536 GCTGGAAGGCAGAAGGGAGATGG - Intergenic
1137422809 16:48350570-48350592 CCTTGAAAGAAGATGCCAGTGGG + Intronic
1138428341 16:56951352-56951374 ACTGGATGGCTGATGACAGAGGG + Intergenic
1138553159 16:57758091-57758113 CCTAGAGGACAGATCCCAGAGGG + Intergenic
1139033749 16:62917699-62917721 AGTGGATGGCAGATGCCATATGG - Intergenic
1139116509 16:63960930-63960952 CCTGGAAAAAAGATGTCAGAGGG + Intergenic
1139293264 16:65876918-65876940 TGTGGAAGACAGATGACAGAAGG + Intergenic
1139561408 16:67744708-67744730 CCCGGAAGGAACATACCAGAGGG + Intronic
1139755734 16:69142091-69142113 CATGAAAGGCAGAGGCCAAACGG - Intronic
1140021139 16:71239904-71239926 ACAGGAAGGCAGAGGCCAGTGGG + Intergenic
1140197742 16:72869288-72869310 CCTTGAAGGATGATGGCAGAGGG - Intronic
1140859200 16:79004569-79004591 CCTGCAAGCCAGAGGCCTGAAGG - Intronic
1141427324 16:83952783-83952805 CCAGGCAGGCTGGTGCCAGAGGG + Intronic
1141592286 16:85077074-85077096 CCAGGGAGGCAGAAGCCAGCTGG - Intronic
1142283535 16:89161397-89161419 CGTGGAAGGCACATTCCAGAAGG + Intergenic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1143139976 17:4736395-4736417 AGAGGAAGGCAGATGACAGACGG + Intronic
1144468792 17:15518481-15518503 TCTGGAAAGCAGATGACAGCTGG + Intronic
1145279918 17:21459604-21459626 CCTGGATGGCAGATGCTCGTGGG + Intergenic
1146275515 17:31513427-31513449 CCTGGAGGGGAGATGCTGGAAGG - Intronic
1147972104 17:44223915-44223937 GCTTCAAGGCACATGCCAGAAGG - Intergenic
1148119217 17:45197821-45197843 CCTGGGAGCCCGAGGCCAGATGG + Intergenic
1148128649 17:45249349-45249371 CCTGGAAGGCTGAGGGTAGAGGG + Intergenic
1148984424 17:51609423-51609445 CCTGGAAAAAACATGCCAGAAGG - Intergenic
1150221940 17:63500724-63500746 CCTGGAAGGCAGCTGGGAGATGG - Intronic
1150452825 17:65283466-65283488 AATGGAAGCCAGATCCCAGATGG + Intergenic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151334977 17:73434416-73434438 CTTGGAAGCCAGAAGCAAGACGG + Intronic
1151646208 17:75433763-75433785 CCTGGAAGGCAGCAGCAAGCAGG + Intergenic
1152389347 17:79993427-79993449 CCTGCAAGGCAGAGGACACAGGG - Intronic
1154288577 18:13084346-13084368 CCTGTAAGGCAGTAGCCTGACGG - Intronic
1155120521 18:22814915-22814937 CCTGGAAGTTTGATGCCTGAAGG + Intronic
1155273835 18:24167118-24167140 CCTCCCAGCCAGATGCCAGAGGG + Intronic
1155797737 18:30060849-30060871 CCTGCGTGGCAGATGGCAGACGG - Intergenic
1157682808 18:49620112-49620134 CTTGGAAGGCAGTTGCCCAAGGG + Intergenic
1159266256 18:66083859-66083881 TCTGGGAGGCAGAGGTCAGAAGG - Intergenic
1160130833 18:76223562-76223584 CCTGACAGGCACATGCCAGCAGG + Intergenic
1160266007 18:77341261-77341283 CCGTGAAGGAAGATGCAAGATGG - Intergenic
1160392033 18:78541149-78541171 CCTGGAAGGCACACGAGAGAAGG - Intergenic
1160663924 19:314067-314089 CCTGAAATGCAGAGGCCTGAGGG + Intronic
1160977470 19:1800449-1800471 TCTGGAAGGCAGACGCGACAGGG + Exonic
1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG + Intronic
1162014861 19:7839940-7839962 CCTGGAGAGCAGAGGCCAGTTGG + Intronic
1162858506 19:13488123-13488145 CCTGGGAGGGAGGTGCCAGCAGG + Intronic
1163551828 19:17969726-17969748 CCTGGCAGACAGAACCCAGAGGG - Intronic
1164667592 19:30051762-30051784 CCTGGAAGACAGAGGCAAGGGGG + Intergenic
1164795393 19:31023027-31023049 CCTAGAAGACAGAAACCAGATGG + Intergenic
1165894515 19:39133616-39133638 CCTGGAATGCAGACAGCAGAAGG - Intronic
1166822636 19:45589948-45589970 CCTGGAGGAGTGATGCCAGAAGG - Exonic
1167462389 19:49632593-49632615 CCTGGAAGGCTGAAGCCAACTGG - Intergenic
1167995583 19:53399349-53399371 CAGGGAAGGGAGATGCCTGATGG - Intronic
925296154 2:2778957-2778979 TCTGGAAGCCATAAGCCAGAAGG - Intergenic
925296922 2:2783446-2783468 TCTGAAAGCCAGAAGCCAGAAGG + Intergenic
925309034 2:2868947-2868969 CCTGGGAGGTAGGTGCCAGTTGG + Intergenic
925366203 2:3313854-3313876 CGAGGAAGGCAGAGGCAAGAGGG + Intronic
925456681 2:4022129-4022151 TCAGGAAGGCCGATGCCAGGTGG + Intergenic
925646620 2:6043477-6043499 CCTGAGAGGGAGCTGCCAGAGGG + Intergenic
926872543 2:17438880-17438902 CATAGAACACAGATGCCAGAGGG - Intergenic
926952749 2:18261329-18261351 CCTAGATGGCAGCTGCCTGAGGG + Intronic
927051389 2:19333003-19333025 CCTAGAAGACAGATTCCACAAGG + Intergenic
928425087 2:31171176-31171198 CCTGGAATGCTGAGGCCAGTTGG - Intergenic
928462208 2:31485457-31485479 CCTGGGAGGGAGATCCCAGACGG - Intergenic
930305107 2:49666885-49666907 CCTGGAACGGAGCTCCCAGAGGG - Intergenic
930513237 2:52372803-52372825 CTGGGAAGACAGATTCCAGATGG + Intergenic
932282854 2:70509684-70509706 CATGCAAGGCAGATAGCAGATGG + Intronic
932330753 2:70897085-70897107 GTTGGAAGGGAGATGCCAGACGG - Intergenic
932398534 2:71464412-71464434 CCTGAAAGGGAGATGAAAGAGGG + Intronic
932739448 2:74280584-74280606 ACTGGAAGGTTGATTCCAGATGG + Intronic
933310984 2:80661055-80661077 CCAGAAAGGCACATGCCAGGTGG - Intergenic
933702290 2:85263993-85264015 CGTGGAAGGCAGGTGGCAGTGGG + Intronic
935667261 2:105523544-105523566 GCTGGAGGGCAGATCACAGAAGG + Intergenic
936558180 2:113514064-113514086 CCTGAAAGCCAGATGCTACAAGG + Intergenic
937118039 2:119423057-119423079 TGGGGAAGGCTGATGCCAGAGGG + Intergenic
937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG + Intergenic
937327742 2:121001803-121001825 CCTGGATGCCACATGCCAGGTGG - Intergenic
939881110 2:147632434-147632456 AAAGGAAGCCAGATGCCAGAGGG - Intergenic
943675812 2:190715599-190715621 CCAGAAAGGCAGAGGCCAGGGGG + Intergenic
944445678 2:199785897-199785919 CATGGATGGCAGATGGCAGGGGG + Intronic
944673043 2:202011964-202011986 CCTGGAAAGCTGAGGCCAGAGGG + Intergenic
945309511 2:208294877-208294899 GCTGGAAGCCAGAAGCCGGAGGG + Intronic
945771730 2:214051739-214051761 CCTGGAAGGCAGATTTCTCATGG - Intronic
946167154 2:217871318-217871340 CCTTGAAGTCACAGGCCAGAAGG + Intronic
946224930 2:218259413-218259435 CCTGGAAGTCACATATCAGAAGG + Intergenic
946659163 2:221980878-221980900 TCTGGAAGCCAGATAACAGAAGG - Intergenic
948560851 2:238849828-238849850 CCTGGATGGCGGATGAGAGAGGG - Intronic
948563249 2:238867676-238867698 GATGCAAGGCAGATGCCACATGG + Intronic
948599484 2:239100201-239100223 CAGGGAAGGCAGAGGCCAGGAGG - Intronic
949000895 2:241612359-241612381 CCTCTCAGGCACATGCCAGATGG - Intronic
949013410 2:241695286-241695308 GCTGGAAGGCTGATGTCAGCTGG - Intergenic
949035782 2:241815197-241815219 CATGGAAGGGAGATTCCAGCGGG + Intronic
1169909198 20:10633505-10633527 CCTGGAAGGAAGCTGCCAGGGGG + Intronic
1170285737 20:14706454-14706476 CTTGGAAGTCAGAGGCCACAAGG - Intronic
1170536656 20:17347290-17347312 CATGGCAGTCAGATGCCAGGAGG - Intronic
1171113918 20:22508278-22508300 CCAAGGAGGCAGGTGCCAGAGGG - Intergenic
1171338210 20:24407041-24407063 ACTGGCAGGCAGACGCCCGAGGG - Intergenic
1172034104 20:31999849-31999871 TCTAGAAGGCAGCAGCCAGATGG - Exonic
1172536219 20:35675388-35675410 TCTGGAAGATAAATGCCAGAAGG + Intronic
1172811642 20:37652196-37652218 CCTGGAAGGAAGAGGAGAGAGGG + Intergenic
1174049396 20:47757252-47757274 CCTGAAAGGCAGGTTTCAGAGGG - Exonic
1174118177 20:48242293-48242315 ACTGGAAGGGAGATGGCAGCAGG + Intergenic
1174118764 20:48246624-48246646 CCTAAAAGGCAGATTCCAGAGGG - Intergenic
1174276453 20:49407956-49407978 CCTGGAAAGCGGAGGCTAGAGGG - Intronic
1175691450 20:61068517-61068539 CCTGGACGTCAGGAGCCAGAGGG - Intergenic
1175714152 20:61244492-61244514 CCTGGAACAAAGATGCCAGGTGG - Intergenic
1177549437 21:22600986-22601008 CTTGGAAGGTAGAAGCAAGATGG - Intergenic
1177874839 21:26619438-26619460 CCTGGATTGCAGATGAAAGAGGG - Intergenic
1177887470 21:26763382-26763404 CTTGGAGGTCAGAAGCCAGAAGG + Intergenic
1179255836 21:39714540-39714562 CCTGGAGGCCAGAAGCCTGAGGG + Intergenic
1179979828 21:44890137-44890159 GCTGGAAGGAAGCTGCCGGAAGG - Exonic
1180065636 21:45410855-45410877 CCAGGACCGGAGATGCCAGACGG - Intronic
1180078090 21:45473275-45473297 CCAGGACTGAAGATGCCAGAGGG + Intronic
1181568794 22:23755520-23755542 CCAGGAATGGAGCTGCCAGACGG + Intergenic
1182295490 22:29309458-29309480 CCTGGGAGGCAGATAGCGGATGG + Intronic
1183110131 22:35642691-35642713 CGTGGAGGGCAATTGCCAGAGGG + Intergenic
1183963954 22:41430120-41430142 CTTGGAAGGCTGAAGCCAGAAGG - Intergenic
1184116095 22:42423228-42423250 CCAGGAAGGGAGCTGACAGATGG + Intronic
1184679637 22:46063371-46063393 CCTGGCAGGCAGCTGCCCCATGG - Intronic
1185000425 22:48242164-48242186 CCTGGAAAGGAGAGCCCAGATGG + Intergenic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
950410874 3:12836027-12836049 CAAGGAAGGAAGATGCCAGATGG + Exonic
950566036 3:13770252-13770274 CCTGGAAGGCCCATTCCACAGGG + Intergenic
950710130 3:14808035-14808057 CCTCTAAGGCAGATGCCAGCAGG - Intergenic
950809468 3:15637137-15637159 CCTGGGGGACAGATGCCAGGGGG - Intronic
952852594 3:37741244-37741266 CCTGACAGGCAGGTGCCAGGGGG + Intronic
953107139 3:39894292-39894314 TCTGGAAGGCAGTGGCTAGATGG - Intronic
954134493 3:48575733-48575755 CCCGCAGGGCAGATGCCTGAGGG + Exonic
955873168 3:63461347-63461369 ACTGGTAGACAAATGCCAGAGGG - Intronic
956248808 3:67214338-67214360 CCTGGGAGGCAGAAGTCACAGGG - Intergenic
956412103 3:68990291-68990313 GCTGAAAGGCAGCTGTCAGATGG - Intronic
959771754 3:110107292-110107314 CCAAGCATGCAGATGCCAGAGGG + Intergenic
960841459 3:121963329-121963351 CCTGGAATGCAGTTCCCAAAGGG + Intergenic
960912054 3:122659015-122659037 GCTGGGAGGCAGAGGCCAGGAGG + Intergenic
962342513 3:134597212-134597234 CCTGGATGGCAGGGGCAAGAGGG + Intergenic
962456618 3:135570879-135570901 CCTGCAGGGAAGATGGCAGAGGG - Intergenic
962679692 3:137785430-137785452 TGTTGAAGGCAGATGCCATAAGG - Intergenic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
962943247 3:140144769-140144791 CCTGGATTCCAGATGCCAGGTGG - Intronic
964852827 3:161113320-161113342 TTTGGAAGGCTGAAGCCAGAGGG + Intronic
965899227 3:173618241-173618263 GCTGGAATGCAGTTGCAAGATGG + Intronic
967086453 3:186099140-186099162 CCTGGCAGGCAAATGACAGTGGG - Intronic
967687550 3:192435417-192435439 CCTGGGAGTAAGAAGCCAGATGG - Intronic
968226572 3:196976104-196976126 CCTGGCAGGCAGGGGCCTGAGGG - Intergenic
968453050 4:684069-684091 CCCAGAAGGCAGAGGGCAGAGGG + Intronic
968570301 4:1336839-1336861 CCTGGAAGACAGAGAGCAGAGGG - Exonic
969652761 4:8477669-8477691 CCTGGCAGGAAGATGCCTCACGG - Intronic
969897399 4:10318185-10318207 CCTGGAAGGTGGCTGCCACAGGG + Intergenic
970859111 4:20681849-20681871 CCTGCAAAATAGATGCCAGAGGG + Intergenic
971015338 4:22483255-22483277 CCTGGGAAGCACATGCCAGAGGG - Intronic
971156460 4:24088327-24088349 CCTGGGAGACAGAGGACAGAGGG + Intergenic
971684590 4:29747760-29747782 CCAGGAAGGAAAATGACAGATGG + Intergenic
973740072 4:53911157-53911179 CCTGGAAGAGAGATGGCAAATGG - Intronic
974362936 4:60906445-60906467 CCTGGAGGGCTGAGGCCAGTAGG - Intergenic
975106228 4:70571825-70571847 CCTGGGATGGAGCTGCCAGAAGG - Intergenic
975986531 4:80206060-80206082 CCTGAAAAGGAGATTCCAGAAGG - Intergenic
977971345 4:103217698-103217720 CCTGGAATGGAGCTTCCAGAGGG + Intergenic
979778926 4:124624943-124624965 TCTTGAAGGAAGATGACAGAAGG + Intergenic
980526884 4:134000849-134000871 CCTGGAAGCCAGATTGCTGATGG - Intergenic
981748012 4:148069367-148069389 CCTGGAAGGCAGAAGCCAGTAGG - Intronic
981748605 4:148073150-148073172 CCTGGAAGGCAGAGGCATGCTGG - Intergenic
983839204 4:172435346-172435368 CCTGGAAGGCAGATGGGGAAAGG + Intronic
984643418 4:182195969-182195991 CCTGAAAAGAAGTTGCCAGAAGG - Intronic
984902747 4:184599664-184599686 CCTGGAGGTCAGAGGCAAGATGG - Intergenic
985062293 4:186091439-186091461 CCTGGAGGTCAGAAGCAAGATGG + Intergenic
985988937 5:3539185-3539207 CCTGAAATGCAGATGCCTCAAGG + Intergenic
986292470 5:6411241-6411263 CCATGAAGGCAGATGACAGACGG + Intergenic
986630248 5:9765605-9765627 ACTGGAAGGCATCTTCCAGATGG - Intergenic
987710316 5:21495860-21495882 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
988425436 5:31058072-31058094 CTTGGGGGACAGATGCCAGAAGG + Intergenic
988699859 5:33662666-33662688 CCAGCCAGGCAGATGCCACAGGG - Intronic
989781332 5:45267984-45268006 TCTGGAAGGCAGAAAGCAGATGG + Intronic
990732616 5:58826040-58826062 GCTGCAAGGCAGATGCCAACAGG + Intronic
991638086 5:68726192-68726214 CCTGGAAGGAGGGTGCCAGTAGG + Intergenic
991737550 5:69641509-69641531 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991760644 5:69914916-69914938 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991786688 5:70203185-70203207 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991789126 5:70221235-70221257 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991813876 5:70496341-70496363 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991817007 5:70517625-70517647 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991839875 5:70789966-70789988 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
991860788 5:71011283-71011305 CTTGGAAGGAACATGCCAAATGG - Exonic
991879133 5:71203570-71203592 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
991881573 5:71221599-71221621 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
992002897 5:72452536-72452558 CCAGGAAGGAAGAAACCAGATGG - Intronic
992267891 5:75035722-75035744 CCTGGGATGCAGCTCCCAGAGGG + Intergenic
993462658 5:88203577-88203599 ACTAGAAGGCATATGGCAGACGG + Intronic
994422269 5:99535961-99535983 CTTGGAAGGCTGAGGCAAGAGGG - Intergenic
994899785 5:105757077-105757099 CCTGGAAGGCTGAGGCAGGATGG + Intergenic
998232631 5:140370991-140371013 CCTGGATGCTAGATGCTAGAGGG + Intronic
998392310 5:141795266-141795288 GCTGGAAGTCAGATGAGAGAAGG - Intergenic
1000630756 5:163587878-163587900 CCAGGGAAGCAGATGGCAGAAGG - Intergenic
1001044703 5:168362913-168362935 GCTGGAGGGGAGATTCCAGACGG - Intronic
1001098152 5:168792178-168792200 GCTGGAAGGCAGATGGGAGATGG + Intronic
1001958010 5:175861595-175861617 CCTAGAAGGGAGACGGCAGAGGG + Intronic
1003801856 6:9678929-9678951 CCTGGAGGTCAGAAGCAAGATGG + Intronic
1005115071 6:22327056-22327078 GCAGGAAGGCAGAAGCAAGAGGG + Intergenic
1005547374 6:26884650-26884672 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1006022899 6:31127953-31127975 ACTGGAAGGCAGCTCCCTGAGGG + Intronic
1006029646 6:31170031-31170053 CCTGGCAGGCAGGGGCCAGGTGG - Intronic
1007163256 6:39810022-39810044 CCTGGAATGCAGATTGAAGATGG - Intronic
1007318281 6:41007688-41007710 CCTGGCAGGAGGAAGCCAGAAGG - Intergenic
1007430793 6:41775605-41775627 CCTGGAGGGGAGAAGACAGAAGG + Exonic
1008676879 6:53828383-53828405 CCAGGCAGGCTGATGCCGGAGGG + Intronic
1008692767 6:53999504-53999526 CCTGGAAAGGAGTTGCCAGCTGG + Intronic
1009018134 6:57925722-57925744 CTTGGAAGGCTGAGGCAAGAGGG + Intergenic
1009974655 6:70659893-70659915 ATTTGAAGGCAGATGCCTGATGG - Intergenic
1010964152 6:82183900-82183922 AGTGGAAGGCATATGCCAGCAGG - Intronic
1011234671 6:85202766-85202788 TCTGGAAGGCTCATCCCAGAAGG - Intergenic
1011971930 6:93236247-93236269 CTTGGAGGGCAGAAGCCAAATGG - Intergenic
1015419360 6:132988076-132988098 CCTGGAAGGCAGAGATCTGAGGG + Intergenic
1017146253 6:151238410-151238432 CCCTGAAAGCAGATGCCAGTTGG + Intergenic
1017920643 6:158869503-158869525 TCTGGGAGGGAGTTGCCAGATGG - Intergenic
1018565746 6:165150449-165150471 CCTGGAAGGCATAAGGCAGTGGG - Intergenic
1018803219 6:167239097-167239119 CCTGAACGGCGGATGCAAGACGG + Intergenic
1018806902 6:167268856-167268878 CCTGAATGGCTGATGCAAGACGG - Intergenic
1019184492 6:170213207-170213229 CCAGGGAGGCAGAAGACAGACGG + Intergenic
1019701482 7:2476626-2476648 GCTGGAAGGGAGAGGCCCGAGGG - Intronic
1019822890 7:3259168-3259190 CCTGGGAGGCTGAGGCCGGAGGG - Intergenic
1020049440 7:5072278-5072300 CCTGGCACGCAGAAGCCAGAGGG + Intronic
1020100754 7:5393215-5393237 CAGCCAAGGCAGATGCCAGAGGG - Intronic
1024317046 7:48030356-48030378 GCTAGAAGGCAGATGCCGGGTGG - Intergenic
1024462418 7:49672131-49672153 CCTGGAAGTCATACGCCAGGAGG + Intergenic
1024984875 7:55186298-55186320 ACTGCAAGGCAGGTCCCAGAGGG + Intronic
1025943486 7:66089590-66089612 CCTGGGAGGCACATGGCAGGAGG - Exonic
1026680883 7:72465839-72465861 CCTGGAAGGCTGAAGAGAGAAGG - Intergenic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1028851089 7:95538422-95538444 CCTGGAAGGCAGGAGTCACATGG - Exonic
1029621147 7:101690503-101690525 CCTGAGAGGTAGATGCCAGTGGG - Intergenic
1029845443 7:103407275-103407297 CATGGAATGCATATGCCTGATGG - Intronic
1030818261 7:114063593-114063615 CATCAAAGGCACATGCCAGATGG - Intronic
1031947135 7:127854026-127854048 CCTGAAAGGCAGAAAGCAGATGG - Intronic
1031984596 7:128155325-128155347 CCTGGAAGGCAGAGAGGAGAGGG + Intergenic
1032441935 7:131948615-131948637 CCTTGAAGGCAGATGCCCCAGGG - Intergenic
1032481103 7:132247897-132247919 TAAGAAAGGCAGATGCCAGAAGG + Intronic
1034482653 7:151334602-151334624 CTTGGAAGTCAGAAGCAAGATGG - Intergenic
1034637411 7:152578171-152578193 CTTGGAAGTCAGAAGCAAGATGG + Intergenic
1035369664 7:158371999-158372021 CCAGGAGGGCTGATGGCAGAGGG - Intronic
1038473242 8:27843282-27843304 CCTGGAAGGCAGAAATGAGATGG + Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1042096778 8:65224831-65224853 CCTAGAAGGCAGTTGCTACATGG + Intergenic
1043212958 8:77548857-77548879 TCTGGAAGACAGAAGACAGATGG + Intergenic
1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG + Intronic
1044170822 8:89049910-89049932 CCTGGGAGGGAGCTCCCAGAGGG - Intergenic
1044750064 8:95407305-95407327 CCTGGAAGGAAGATGCCCTAGGG - Intergenic
1046190630 8:110790203-110790225 CTTGGAAGTCAGAAGCAAGATGG + Intergenic
1047299168 8:123598029-123598051 GCTGGAAGACTGATGGCAGAAGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048172342 8:132119420-132119442 GATGGAAGGCAGAAGTCAGAAGG + Intergenic
1048385996 8:133913110-133913132 CCTGGAGGGCAGAGGCCAGGTGG - Intergenic
1048869744 8:138787433-138787455 CCTGGAAGGGAGATGACACAAGG + Intronic
1049178309 8:141207115-141207137 CCAGGAAGGCAGAGGGCAGGAGG + Intergenic
1049277103 8:141725363-141725385 CCTGGCAGGCAGAGCCCAGCAGG - Intergenic
1049446826 8:142635096-142635118 GGTGGGAGGCAGAGGCCAGAGGG - Intergenic
1049894682 9:102202-102224 CCTGAAAGCCAGATGCTACAAGG - Intergenic
1049911334 9:271369-271391 ACTGGAAGGATGATGACAGAAGG - Intronic
1049935771 9:500459-500481 CCTGGACTGCAGATGCCATTAGG + Intronic
1050398215 9:5222639-5222661 CCTAGAATGGAGGTGCCAGAGGG + Intergenic
1050827983 9:9973362-9973384 CTTGGAAGGCTGAAGCCGGAGGG + Intronic
1051924820 9:22310997-22311019 CTTGGAAGTCAGAAGCAAGATGG + Intergenic
1052702931 9:31959942-31959964 CCTGGGATGGAGATCCCAGAGGG + Intergenic
1052836997 9:33258218-33258240 CCTGGCAGGCAGAGGCTACAGGG + Intronic
1053196900 9:36126562-36126584 CCATGAAGGTAGATGCCAGAAGG + Intergenic
1053353156 9:37426427-37426449 CCTGGCAGGCAGATCAAAGAGGG + Intronic
1053735888 9:41102192-41102214 CCTGAAAGCCAGATGCTACAAGG - Intergenic
1054692485 9:68329206-68329228 CCTGAAAGCCAGATGCTACAAGG + Intronic
1054793871 9:69280597-69280619 CCTGGAAGATGGAAGCCAGAAGG - Intergenic
1055196104 9:73596158-73596180 CCTGGACGGCAGAATCCAGATGG - Intergenic
1055857153 9:80702967-80702989 CCTGGAAACCAAATGACAGAGGG + Intergenic
1057163382 9:92907233-92907255 CCTGGAAGGCAAAGACCAAAAGG + Intergenic
1057191870 9:93092882-93092904 CTTGGAAGGCAGAGCCCACAGGG + Intergenic
1057801878 9:98195831-98195853 CCTGGAAGGCAGCAGCCCCAGGG + Intergenic
1058528806 9:105885842-105885864 CCTGGGAGGCTGATGCAAGTGGG + Intergenic
1059328950 9:113523107-113523129 ACTGGCAGCCAGATCCCAGAGGG - Intronic
1059586562 9:115613980-115614002 CCTGGAAGGTTGATGCTACAGGG - Intergenic
1059716583 9:116918665-116918687 CGTGTAATGGAGATGCCAGAGGG - Intronic
1059901439 9:118930739-118930761 CCTAGGAGGCAGAAGGCAGAAGG - Intergenic
1060196829 9:121629307-121629329 CCTGGCCGGCTGATGGCAGAGGG + Intronic
1061227417 9:129288777-129288799 CCTGGAAGGCAGGTCTCAGGAGG - Intergenic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1061773532 9:132945274-132945296 ACTTGAAGGCAGAAGCCAGGGGG - Intergenic
1062039380 9:134397029-134397051 CCTGCCAGGCAGAGGCCGGAAGG + Intronic
1062339008 9:136085600-136085622 CCTGGGAGGCGGCTGCCAGGGGG + Intronic
1062427979 9:136514799-136514821 CCTGGAAGGATGTGGCCAGAAGG - Intronic
1185462335 X:339210-339232 CCGTGCAGGCAGAGGCCAGAGGG + Intronic
1185642146 X:1594261-1594283 GCTGGAAGGAAGTCGCCAGAGGG - Intronic
1185680772 X:1886899-1886921 CCTGGGAGGCAGGTACCTGAGGG - Intergenic
1186027269 X:5326832-5326854 CTTGGAAGTCAGAAGCAAGATGG + Intergenic
1188048392 X:25454355-25454377 CCTGGAGTGCAGATGCCACAAGG - Intergenic
1190808881 X:53864536-53864558 TCTGTAAGGCAGGTCCCAGAAGG + Intergenic
1190808908 X:53864672-53864694 TCTGAAAGGCAGGTCCCAGAAGG + Intergenic
1190980958 X:55456362-55456384 CCTGCAAGGGAGATGCCACCAGG + Intergenic
1190987739 X:55516818-55516840 CCTGCAAGGGAGATGCCACCAGG - Intergenic
1191633614 X:63351606-63351628 CCTGGAAGACAGAAAGCAGATGG - Intergenic
1191973047 X:66838693-66838715 CCTGGAAGGTTTATCCCAGAGGG - Intergenic
1192186512 X:68950570-68950592 ACTGGAAGGAAACTGCCAGAAGG - Intergenic
1192923751 X:75734713-75734735 CCTGGAATGGAGCTCCCAGAAGG - Intergenic
1193295778 X:79829876-79829898 CCTGGAATGAAGCTCCCAGAGGG - Intergenic
1193805109 X:85985413-85985435 CCTGGAAGGAAGCTCCCAGAGGG + Intronic
1194620108 X:96160691-96160713 CCTGGAGGTCAGAAGCAAGATGG + Intergenic
1194953484 X:100153470-100153492 CCTGGAATGGAGTTTCCAGAGGG - Intergenic
1195615576 X:106909513-106909535 CTTGCAAGACAGAGGCCAGAGGG - Intronic
1196717287 X:118823929-118823951 CCTGCAAGGCGGAGACCAGAAGG + Exonic
1200722021 Y:6618611-6618633 CCTGGAATGGAGCTCCCAGAGGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic