ID: 1134089851

View in Genome Browser
Species Human (GRCh38)
Location 16:11385554-11385576
Sequence GGCGCAGCAGCCAGAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 611
Summary {0: 1, 1: 0, 2: 4, 3: 62, 4: 544}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134089835_1134089851 26 Left 1134089835 16:11385505-11385527 CCTAGAGCTTTGGCTTAGCCTGC 0: 1
1: 0
2: 0
3: 9
4: 144
Right 1134089851 16:11385554-11385576 GGCGCAGCAGCCAGAGGCCCAGG 0: 1
1: 0
2: 4
3: 62
4: 544
1134089842_1134089851 -4 Left 1134089842 16:11385535-11385557 CCTGGATTCCCCCTCCCCTGGCG 0: 1
1: 0
2: 0
3: 16
4: 241
Right 1134089851 16:11385554-11385576 GGCGCAGCAGCCAGAGGCCCAGG 0: 1
1: 0
2: 4
3: 62
4: 544
1134089840_1134089851 3 Left 1134089840 16:11385528-11385550 CCTGAGGCCTGGATTCCCCCTCC 0: 1
1: 0
2: 3
3: 35
4: 481
Right 1134089851 16:11385554-11385576 GGCGCAGCAGCCAGAGGCCCAGG 0: 1
1: 0
2: 4
3: 62
4: 544
1134089839_1134089851 4 Left 1134089839 16:11385527-11385549 CCCTGAGGCCTGGATTCCCCCTC 0: 1
1: 0
2: 2
3: 26
4: 273
Right 1134089851 16:11385554-11385576 GGCGCAGCAGCCAGAGGCCCAGG 0: 1
1: 0
2: 4
3: 62
4: 544
1134089838_1134089851 8 Left 1134089838 16:11385523-11385545 CCTGCCCTGAGGCCTGGATTCCC 0: 1
1: 0
2: 1
3: 35
4: 354
Right 1134089851 16:11385554-11385576 GGCGCAGCAGCCAGAGGCCCAGG 0: 1
1: 0
2: 4
3: 62
4: 544

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134089851 Original CRISPR GGCGCAGCAGCCAGAGGCCC AGG Intronic