ID: 1134092039

View in Genome Browser
Species Human (GRCh38)
Location 16:11396645-11396667
Sequence GGTCGTCGGGGAGCACACCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134092039_1134092045 -10 Left 1134092039 16:11396645-11396667 CCAGGGTGTGCTCCCCGACGACC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1134092045 16:11396658-11396680 CCCGACGACCAAGAGGGCCTGGG 0: 1
1: 0
2: 0
3: 3
4: 54
1134092039_1134092048 5 Left 1134092039 16:11396645-11396667 CCAGGGTGTGCTCCCCGACGACC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1134092048 16:11396673-11396695 GGCCTGGGACGAGAGAGTCTAGG 0: 1
1: 0
2: 1
3: 21
4: 175
1134092039_1134092055 27 Left 1134092039 16:11396645-11396667 CCAGGGTGTGCTCCCCGACGACC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1134092055 16:11396695-11396717 GTGTCAGGCAGGCACAGGGGTGG 0: 1
1: 0
2: 4
3: 51
4: 357
1134092039_1134092051 16 Left 1134092039 16:11396645-11396667 CCAGGGTGTGCTCCCCGACGACC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1134092051 16:11396684-11396706 AGAGAGTCTAGGTGTCAGGCAGG 0: 1
1: 0
2: 1
3: 16
4: 242
1134092039_1134092053 23 Left 1134092039 16:11396645-11396667 CCAGGGTGTGCTCCCCGACGACC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1134092053 16:11396691-11396713 CTAGGTGTCAGGCAGGCACAGGG 0: 1
1: 0
2: 1
3: 22
4: 198
1134092039_1134092052 22 Left 1134092039 16:11396645-11396667 CCAGGGTGTGCTCCCCGACGACC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1134092052 16:11396690-11396712 TCTAGGTGTCAGGCAGGCACAGG 0: 1
1: 0
2: 0
3: 20
4: 222
1134092039_1134092054 24 Left 1134092039 16:11396645-11396667 CCAGGGTGTGCTCCCCGACGACC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1134092054 16:11396692-11396714 TAGGTGTCAGGCAGGCACAGGGG 0: 1
1: 0
2: 3
3: 91
4: 669
1134092039_1134092050 12 Left 1134092039 16:11396645-11396667 CCAGGGTGTGCTCCCCGACGACC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1134092050 16:11396680-11396702 GACGAGAGAGTCTAGGTGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134092039 Original CRISPR GGTCGTCGGGGAGCACACCC TGG (reversed) Exonic
900366720 1:2314681-2314703 GGGCGTCGGGGAGGCCGCCCCGG - Intergenic
903542720 1:24105969-24105991 CGCCGTCTGGGAGCACACCACGG - Exonic
906640528 1:47438279-47438301 GGCCGTGGGGGAGCACGTCCCGG - Exonic
908859601 1:68468650-68468672 GGTCTTTTGGGAGCACACACAGG + Intergenic
917847672 1:179035326-179035348 GGTCGTGGGGCAGCACCCACAGG + Intronic
1070628730 10:78069330-78069352 GGTCCTCAGGGAGTGCACCCTGG + Intergenic
1075262080 10:120971840-120971862 GGTGGTCTGAGACCACACCCAGG - Intergenic
1075863594 10:125698285-125698307 GGGGGTGGGGGAGCACAGCCAGG + Intergenic
1076680344 10:132168457-132168479 AGGCGTCGGGGAGCCCTCCCAGG - Exonic
1077285669 11:1764174-1764196 GGTCGTGGGGCGGCCCACCCTGG + Intergenic
1083336871 11:61927433-61927455 AGTCGTCTGGGAGCACATCCAGG + Intergenic
1083746032 11:64736917-64736939 GGTCCTTGAGGTGCACACCCAGG + Exonic
1096276957 12:50217676-50217698 GGTCGTGGGGCAGCACCCGCAGG + Intronic
1102236592 12:111297910-111297932 GGTAGTCAGGGAGAACTCCCTGG + Intronic
1104960532 12:132486634-132486656 GCTGGTCGGGGACCACACTCTGG - Intergenic
1106665457 13:31846747-31846769 GGTCGCCGGGCAGCAGAGCCCGG + Intergenic
1107851491 13:44576810-44576832 GGTCCTCGCGGAGCACGGCCGGG + Intronic
1110440237 13:75518837-75518859 GGCTGTCGGGGAGCCCACCGGGG - Intergenic
1118748298 14:68789722-68789744 GGTGGTCGGGGAGCCACCCCCGG + Exonic
1118813369 14:69291593-69291615 GGTGGTCGGTGAGCACAGCATGG - Intronic
1121313256 14:92946430-92946452 GGTCATCCGGGAGCTCTCCCGGG - Exonic
1123066184 14:105620633-105620655 GGCCGTCAGGGAGGACTCCCGGG - Intergenic
1123095353 14:105764633-105764655 GGCCGTCAGGGAGGACTCCCGGG - Intergenic
1125724316 15:41860623-41860645 GGGCCTCGGGGTGCCCACCCTGG + Exonic
1128944769 15:71812728-71812750 GATGGTCGGGGTGCACACCTAGG + Intronic
1132698476 16:1212304-1212326 GGCCGTCGGGGAGCCCGCCATGG + Intronic
1133113693 16:3564318-3564340 GCACGTCGGGGAGCCCAGCCTGG - Exonic
1134092039 16:11396645-11396667 GGTCGTCGGGGAGCACACCCTGG - Exonic
1134402497 16:13922351-13922373 GGTCGTGGGGCAGCACCCACAGG + Intronic
1134452495 16:14372138-14372160 GGTTGCCGGGGAGACCACCCTGG - Intergenic
1136146006 16:28317179-28317201 GGTCTTCGGGGAGCTGACTCAGG + Intronic
1139593695 16:67946631-67946653 GGTCTGTGGGGAACACACCCAGG + Exonic
1152094260 17:78263859-78263881 GGTGGTTGGGGAACCCACCCAGG - Intergenic
1152172963 17:78765747-78765769 GGTTCTTGGGGAGCACATCCAGG - Intronic
1157718172 18:49903592-49903614 GGTCAGGGTGGAGCACACCCTGG - Intronic
1163640083 19:18457206-18457228 GGGCGTCGGGGAGCTTCCCCGGG - Intronic
1165265918 19:34663955-34663977 GGTGGGCGGGGAGGACAACCCGG - Intronic
925435907 2:3837461-3837483 GGCTGTAGGGGAGCACACACTGG + Intronic
926152379 2:10432378-10432400 GGCCGTCGGGGAACAGACTCCGG + Intergenic
928149224 2:28811013-28811035 GGTCGCCGGCGAGCGAACCCAGG - Intronic
934991517 2:98925023-98925045 GGTCGTCCTGGACCGCACCCTGG - Intronic
936038079 2:109128647-109128669 GGTCGTCGGGGAGGATGCCCGGG + Intergenic
937932877 2:127219686-127219708 GGTCTTCGGGAAGCGGACCCCGG - Intronic
941112284 2:161428134-161428156 GGGCGTCCGGGAGCTCGCCCGGG + Intronic
947625093 2:231614096-231614118 GGTACCCGCGGAGCACACCCGGG - Intergenic
1172895414 20:38296402-38296424 GGTCCTTGGGGAGGCCACCCTGG + Intronic
1173743127 20:45416459-45416481 CCTCGTCGGGGTCCACACCCAGG - Intronic
1179229824 21:39491563-39491585 GGTCGTGGGGCAGCACCCGCAGG + Intronic
950495005 3:13328497-13328519 GTGCCTCGGGGAGCACTCCCTGG + Intronic
950503118 3:13376896-13376918 GCTCGTCAGTGAGCACCCCCAGG - Intronic
954879555 3:53824111-53824133 GGCCGTTGGTGAGCATACCCTGG - Intronic
956749416 3:72334301-72334323 GGTCGGCTGGGAGCTCAGCCTGG - Intergenic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
968555498 4:1244638-1244660 GGTGGTCGGGGAGCCCTTCCTGG - Intronic
979089280 4:116459527-116459549 GGTCTCAAGGGAGCACACCCTGG + Intergenic
979625519 4:122840649-122840671 GGTCGTGGGGCAGCACCCACAGG - Intronic
990660530 5:58009315-58009337 GGTCATAGGGGAGCACAACGTGG - Intergenic
992494966 5:77282922-77282944 TGACCTCGGGGAGCACTCCCTGG + Intronic
999299983 5:150485426-150485448 GGTGGTCGGGGAGCTGTCCCAGG + Intergenic
1002441211 5:179265441-179265463 CGTGGAGGGGGAGCACACCCTGG + Intronic
1003162104 6:3644836-3644858 GGGCGTCGGGGAACACAAGCAGG + Intergenic
1004114132 6:12749866-12749888 GGGCGGCGGGGAGGACGCCCGGG - Intronic
1006984759 6:38169101-38169123 GGTCCTCAGGGAGCACAGCCCGG - Exonic
1016116342 6:140290568-140290590 GGTAGTTGGGGAGCAGCCCCAGG - Intergenic
1019573793 7:1726514-1726536 GGACCCCGGGGAGCACACTCTGG - Intronic
1019577076 7:1742695-1742717 GGGCCTCGGGGAGCTAACCCAGG - Intronic
1029150731 7:98478570-98478592 GGTCATGGGGCAGCACCCCCAGG + Intergenic
1031484320 7:122310215-122310237 GGTCGGCGCGGGGCACTCCCGGG - Intronic
1033288625 7:140062811-140062833 CGTCGTCGGTGAGGTCACCCAGG - Exonic
1035021409 7:155803172-155803194 GGTCATCGAGGAGCACAGCTGGG - Exonic
1049517095 8:143065934-143065956 GGTCGTGGGGCAGCACCCACAGG + Intergenic
1050619257 9:7435306-7435328 AGTAGTCGGGGAACACACACTGG - Intergenic
1053135247 9:35646812-35646834 CGTCGTCAGGGACCAGACCCTGG + Intergenic
1061996435 9:134188553-134188575 GGCCGTCTGGGAGGACACGCTGG + Intergenic
1062697323 9:137882053-137882075 GGTCGTCGCTCAGCACACTCAGG + Intronic
1192174548 X:68877764-68877786 GGTGGTCCGGGAGCTCAGCCTGG - Intergenic
1196006636 X:110843827-110843849 GGACGTCGAGGAGAACACACTGG + Intergenic
1196719334 X:118839348-118839370 GGGCTTCGCGGAGCACGCCCTGG + Intergenic