ID: 1134093814

View in Genome Browser
Species Human (GRCh38)
Location 16:11405710-11405732
Sequence AGGAAGCCCCATAATGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134093814_1134093819 3 Left 1134093814 16:11405710-11405732 CCCTGCCCATTATGGGGCTTCCT No data
Right 1134093819 16:11405736-11405758 TGCTCACTTCTGCCACCTGTAGG No data
1134093814_1134093824 28 Left 1134093814 16:11405710-11405732 CCCTGCCCATTATGGGGCTTCCT No data
Right 1134093824 16:11405761-11405783 CCTCCCCACACAGCAGCCAGAGG No data
1134093814_1134093825 29 Left 1134093814 16:11405710-11405732 CCCTGCCCATTATGGGGCTTCCT No data
Right 1134093825 16:11405762-11405784 CTCCCCACACAGCAGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134093814 Original CRISPR AGGAAGCCCCATAATGGGCA GGG (reversed) Intronic
No off target data available for this crispr