ID: 1134097105

View in Genome Browser
Species Human (GRCh38)
Location 16:11425160-11425182
Sequence CGGCACGGACAGCTTGCGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 40
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 36}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134097105_1134097125 24 Left 1134097105 16:11425160-11425182 CCACCCGCAAGCTGTCCGTGCCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1134097125 16:11425207-11425229 CAGAGCCAGGCTGGCTGCATGGG 0: 1
1: 1
2: 3
3: 64
4: 580
1134097105_1134097120 15 Left 1134097105 16:11425160-11425182 CCACCCGCAAGCTGTCCGTGCCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1134097120 16:11425198-11425220 GGCGCCACCCAGAGCCAGGCTGG 0: 1
1: 0
2: 3
3: 37
4: 353
1134097105_1134097124 23 Left 1134097105 16:11425160-11425182 CCACCCGCAAGCTGTCCGTGCCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1134097124 16:11425206-11425228 CCAGAGCCAGGCTGGCTGCATGG 0: 1
1: 1
2: 7
3: 79
4: 527
1134097105_1134097127 29 Left 1134097105 16:11425160-11425182 CCACCCGCAAGCTGTCCGTGCCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1134097127 16:11425212-11425234 CCAGGCTGGCTGCATGGGCCCGG 0: 1
1: 0
2: 5
3: 45
4: 499
1134097105_1134097114 -6 Left 1134097105 16:11425160-11425182 CCACCCGCAAGCTGTCCGTGCCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1134097114 16:11425177-11425199 GTGCCGGGGGCCCCAGGAGCAGG 0: 1
1: 1
2: 3
3: 52
4: 433
1134097105_1134097119 11 Left 1134097105 16:11425160-11425182 CCACCCGCAAGCTGTCCGTGCCG 0: 1
1: 0
2: 0
3: 3
4: 36
Right 1134097119 16:11425194-11425216 AGCAGGCGCCACCCAGAGCCAGG 0: 1
1: 0
2: 3
3: 27
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134097105 Original CRISPR CGGCACGGACAGCTTGCGGG TGG (reversed) Exonic
915318866 1:155045019-155045041 CTGAAAGGACAGCTGGCGGGAGG + Intronic
915516309 1:156414653-156414675 CACCACGGACAGCTCCCGGGCGG - Exonic
1067152696 10:43749562-43749584 CGGGACGGAGAGCGTGCTGGAGG + Intergenic
1068044707 10:51871541-51871563 CAGCACTGACAGCTTGGGGCTGG - Intronic
1076399763 10:130174303-130174325 CTGCACGGGCAGCTTCCAGGAGG + Intronic
1084667710 11:70585361-70585383 GGGCAGGGACAGCATGAGGGAGG + Intronic
1090189068 11:124756656-124756678 CCGCAGGGACAGGTTCCGGGAGG + Exonic
1104972408 12:132537960-132537982 CTGCACGGAGAGCTCGGGGGAGG + Intronic
1105578440 13:21673736-21673758 CGGCCCCGACACCCTGCGGGTGG - Intronic
1110913977 13:80998819-80998841 CGGCTCCCTCAGCTTGCGGGAGG - Intergenic
1114557816 14:23571776-23571798 AGGCATGGACAGCTGGGGGGAGG - Intronic
1129687816 15:77696498-77696520 CGGCACAGCCAGCCTTCGGGCGG - Intronic
1129880621 15:79004079-79004101 CGGCGAGGAGAACTTGCGGGTGG + Exonic
1132670421 16:1100216-1100238 CAGCACGGTCACCTGGCGGGCGG - Intergenic
1134097105 16:11425160-11425182 CGGCACGGACAGCTTGCGGGTGG - Exonic
1136531768 16:30874873-30874895 TGACACGGTCAGCTCGCGGGTGG + Intronic
1137248600 16:46726862-46726884 CCGCACGGAGGGCTGGCGGGAGG + Intronic
1151181795 17:72334529-72334551 GGGCACGGACAGCTTCCCAGGGG + Intergenic
1166140179 19:40801148-40801170 CGTCAAGGACAGCTTCCTGGGGG + Exonic
935192742 2:100792046-100792068 CTGCCCTGACAGCCTGCGGGAGG + Intergenic
1171112325 20:22495455-22495477 AGGCAGGCACAGCTTGCAGGTGG - Intergenic
1173087616 20:39939309-39939331 CAGGAAGGACAGCTTGGGGGTGG - Intergenic
1182296633 22:29314109-29314131 CGGCCCGGAAAGCTTGGGGGAGG - Intronic
1184128902 22:42505514-42505536 GGGCAGGGACAGCTTGCCTGGGG - Intergenic
1184137697 22:42558829-42558851 GGGCAGGGACAGCTTGCCTGGGG - Intronic
1185259653 22:49854185-49854207 CGGCCCTGACAGCTGGCGCGGGG + Intronic
953495991 3:43387407-43387429 CGGCAGGGAGAGCTTGAGGAGGG + Intronic
964474808 3:157088958-157088980 CGGCACGTCCAGCGCGCGGGCGG + Intergenic
976690651 4:87864055-87864077 CGGCTCCCTCAGCTTGCGGGAGG - Intergenic
990988859 5:61665805-61665827 CCGAACTGACAGCTTGGGGGCGG + Intronic
994320802 5:98392461-98392483 CAGCTCGGACAGCTTGCGGTTGG + Intergenic
1015927424 6:138324046-138324068 CGGCACGGAGAGCTTCAGCGGGG + Exonic
1025182777 7:56832064-56832086 CGGCACGGAGAGCCTGTCGGGGG + Intergenic
1025689149 7:63744910-63744932 CGGCACGGACAGCCTGTCGGGGG - Intergenic
1037877267 8:22554269-22554291 AGGCACGGGCAGCCTGCAGGCGG + Intronic
1052824995 9:33167716-33167738 CGGAGAGGACAGCTGGCGGGTGG + Intergenic
1053409202 9:37904628-37904650 AAGCTCAGACAGCTTGCGGGGGG + Intronic
1062568966 9:137175754-137175776 CGCCACAGACAGCGTGCGGTCGG + Exonic
1201862896 Y:18618639-18618661 GGGCAAAGACAGCTTGAGGGTGG + Intergenic
1201870427 Y:18701739-18701761 GGGCAAAGACAGCTTGAGGGTGG - Intergenic