ID: 1134098654

View in Genome Browser
Species Human (GRCh38)
Location 16:11436253-11436275
Sequence TTGCAACTCCTCCACAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134098652_1134098654 13 Left 1134098652 16:11436217-11436239 CCTGAAGGGGGCTGGTGGGGGAA No data
Right 1134098654 16:11436253-11436275 TTGCAACTCCTCCACAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134098654 Original CRISPR TTGCAACTCCTCCACAGAAA AGG Intronic
No off target data available for this crispr