ID: 1134099868

View in Genome Browser
Species Human (GRCh38)
Location 16:11444457-11444479
Sequence AGGGCTTCACTTGCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134099868_1134099876 19 Left 1134099868 16:11444457-11444479 CCTGTTTTTGCAAGTGAAGCCCT No data
Right 1134099876 16:11444499-11444521 CGTTCATTACGTATTATTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134099868 Original CRISPR AGGGCTTCACTTGCAAAAAC AGG (reversed) Intronic
No off target data available for this crispr