ID: 1134102082

View in Genome Browser
Species Human (GRCh38)
Location 16:11459723-11459745
Sequence CCCCATGACCCCATGTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 1, 2: 5, 3: 31, 4: 337}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134102082_1134102087 7 Left 1134102082 16:11459723-11459745 CCTGGGGACATGGGGTCATGGGG 0: 1
1: 1
2: 5
3: 31
4: 337
Right 1134102087 16:11459753-11459775 TGCAAAAGGGAAAGTCACCAAGG 0: 1
1: 0
2: 0
3: 28
4: 295
1134102082_1134102086 -6 Left 1134102082 16:11459723-11459745 CCTGGGGACATGGGGTCATGGGG 0: 1
1: 1
2: 5
3: 31
4: 337
Right 1134102086 16:11459740-11459762 ATGGGGCTGGAGATGCAAAAGGG 0: 1
1: 0
2: 1
3: 38
4: 375
1134102082_1134102085 -7 Left 1134102082 16:11459723-11459745 CCTGGGGACATGGGGTCATGGGG 0: 1
1: 1
2: 5
3: 31
4: 337
Right 1134102085 16:11459739-11459761 CATGGGGCTGGAGATGCAAAAGG 0: 1
1: 0
2: 4
3: 29
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134102082 Original CRISPR CCCCATGACCCCATGTCCCC AGG (reversed) Intronic
900410069 1:2508386-2508408 CCCGCAGACCCCATGGCCCCGGG - Intergenic
900934596 1:5757169-5757191 CCCCAAGACCACATGAGCCCCGG + Intergenic
901079204 1:6574424-6574446 TCCCCTCACCCCTTGTCCCCAGG + Intronic
901640175 1:10689079-10689101 CCCCATGCCCCCAGGCCCCAAGG - Intronic
901644487 1:10709227-10709249 CCCCGAGCCCCCATGGCCCCGGG - Intronic
902503727 1:16926420-16926442 CCCCTTGTCCCCATGGCCACAGG + Intronic
903269147 1:22176980-22177002 CCCAATGTCCCCATGTCCTCTGG - Intergenic
903947151 1:26971207-26971229 CACCATCACCCCATGACCTCTGG - Intergenic
904339861 1:29827763-29827785 ACCCATGACCCCACTTCCCTGGG + Intergenic
904496958 1:30892420-30892442 CCCCAGGCCCCCAGGCCCCCAGG + Intronic
904887714 1:33753760-33753782 CCCCATGCACCAATGTGCCCAGG + Intronic
905447184 1:38034947-38034969 CCCCAAGGCCTCAGGTCCCCAGG - Intergenic
905463520 1:38136492-38136514 GGCCCTCACCCCATGTCCCCAGG + Intergenic
905463525 1:38136500-38136522 CCCCATGTCCCCAGGTCCCCGGG + Intergenic
907333815 1:53687792-53687814 CCCCAGGCCCCCATGTCACCAGG + Intronic
907444304 1:54498302-54498324 CCCCATGTCCCCATGTCCATTGG + Intergenic
910563579 1:88618719-88618741 ACACATGACACCATGTCCCAAGG + Intergenic
912544080 1:110438434-110438456 CCCCACAACATCATGTCCCCTGG - Intergenic
912554223 1:110504417-110504439 CCCCACGACATCATGTTCCCTGG - Intergenic
913530336 1:119729487-119729509 CCCCATGACTCCCCTTCCCCAGG + Intronic
915306672 1:154983851-154983873 ACCCAGGACCCCCTGTTCCCAGG + Exonic
915373309 1:155370369-155370391 CCCCATTACCCCAGATCCCACGG - Intronic
917204879 1:172561759-172561781 TCCCCTGACTCCAAGTCCCCTGG + Intronic
919231380 1:194779296-194779318 CCTCATGAGCCCATGCCGCCAGG + Intergenic
919607005 1:199695335-199695357 CCACATGACCCTATGTCCGCTGG - Intergenic
919778591 1:201209088-201209110 TCCAGTGACCCCATCTCCCCAGG - Exonic
919938498 1:202270796-202270818 CCCTATGTCCCCATCTCCCTGGG + Intronic
920677252 1:208046743-208046765 TCCCATGCTCCCTTGTCCCCAGG - Intronic
922399697 1:225239307-225239329 CCCCGTGAGCCCATGCCACCAGG - Intronic
923778658 1:237001973-237001995 CACAATCACCCCATGTCACCAGG + Intergenic
924525230 1:244840460-244840482 CCACATGATCATATGTCCCCTGG + Intronic
1063119086 10:3092133-3092155 CTCCATCTCCCCATGGCCCCCGG + Intronic
1063957729 10:11282041-11282063 CCCCAGGTCCCCATATCCACTGG - Intronic
1064157477 10:12915952-12915974 CCCCATGGCTCCAGGTACCCAGG - Intronic
1067066903 10:43109272-43109294 CCCTGTGCCCCCATGTCCCTTGG - Intronic
1067067528 10:43112270-43112292 CCCCAGGACCCCGTTTCCACCGG - Intronic
1069961401 10:72081324-72081346 TTCCCTGACCCCTTGTCCCCTGG - Intronic
1070568379 10:77620974-77620996 TTACATGACCCCATATCCCCGGG + Intronic
1071245289 10:83754769-83754791 CCCCTTGAACCCATTTGCCCTGG + Intergenic
1071441525 10:85701811-85701833 ACCCTTGCCCCCAAGTCCCCTGG - Intronic
1072208636 10:93226205-93226227 CCCCATGACCTCATTTTTCCTGG - Intergenic
1072738985 10:97898300-97898322 CCCCATGACCCACTCTCCCTAGG - Intronic
1073134886 10:101215029-101215051 CCCAATGGCCCCATGTACCCAGG - Intergenic
1075091822 10:119448087-119448109 CCCCATGAAGCCACGTCCCCTGG - Intronic
1075230364 10:120671321-120671343 CCTCATGAGCCCATGCCACCAGG + Intergenic
1075724522 10:124604595-124604617 CCCCAGGAGCCCAAGACCCCCGG - Intronic
1076510885 10:131012885-131012907 CCCTGTGACCCCATGTGGCCTGG + Intergenic
1076521453 10:131083951-131083973 TCCCACGAGCCCATGTCCTCAGG - Intergenic
1076892586 10:133292119-133292141 CCCCATGTCCCCGTGTCCCGGGG + Intronic
1076892613 10:133292204-133292226 CCCCATGTCCCCGTGTCCCGGGG + Intronic
1076892640 10:133292289-133292311 CCCCATGTCCCCGTGTCCCGGGG + Intronic
1076892667 10:133292374-133292396 CCCCGTGTCCCCGTGTCCCGGGG + Intronic
1076932964 10:133546068-133546090 CCTCATGAGCCCATGTCACCAGG + Intronic
1077367542 11:2167204-2167226 CCTCATGGCCCCCTATCCCCTGG - Intronic
1077393847 11:2311706-2311728 CCCCATGACCAGATCTTCCCTGG - Intronic
1077855008 11:6115708-6115730 CCTCATGAGCCCATGCCACCGGG + Intergenic
1083571480 11:63764109-63764131 CCCCAGGGCCCCATCCCCCCCGG - Exonic
1083725161 11:64624082-64624104 CCACATTGCCCCATCTCCCCCGG + Intronic
1085249179 11:75130880-75130902 CACCAAGATCGCATGTCCCCAGG - Intronic
1085772853 11:79340307-79340329 CCCCCTGACCCCACCTCCCTGGG - Intronic
1089452600 11:118608289-118608311 CCCCAAGGCCCCACGTCCTCGGG + Intronic
1091456864 12:614446-614468 CCCCACCCCACCATGTCCCCTGG - Intronic
1091492979 12:949152-949174 CGGCATGCCCCCATGTTCCCTGG - Intronic
1091563330 12:1630368-1630390 CCCCGAGAGCCCCTGTCCCCAGG - Intronic
1091974067 12:4810759-4810781 CCCCCGGTCCCCATTTCCCCAGG - Exonic
1092160955 12:6315249-6315271 CCACATGACCCCACTTCCCAAGG - Intronic
1092258804 12:6941575-6941597 CTCGCTGAGCCCATGTCCCCTGG - Intronic
1093187470 12:16037774-16037796 CCCCATGTCTCCCTGTCCCTCGG + Intergenic
1093898882 12:24607009-24607031 CACCAAGGCCCCATCTCCCCCGG - Intergenic
1094840035 12:34338997-34339019 CCCCAGATCCCCATGTCCCCAGG - Intergenic
1097763655 12:63498287-63498309 TCCCCTGACCCCCTGGCCCCTGG + Intergenic
1098505614 12:71247053-71247075 CCCCATGGCCCCATATACCATGG - Intronic
1101192212 12:102346658-102346680 TCTCATGACTCCATGTCCTCTGG - Intergenic
1101616406 12:106342248-106342270 CCCCAGCATTCCATGTCCCCAGG - Intronic
1102632793 12:114296472-114296494 CCACAAGACCCCACTTCCCCTGG + Intergenic
1103072745 12:117958167-117958189 CCCCATTACCCCAGGTACCAAGG + Intronic
1104730617 12:131103527-131103549 TCCCATGGCCCCCTGGCCCCAGG + Intronic
1104820038 12:131671900-131671922 CCCCATGACCACCTGAGCCCTGG + Intergenic
1104897250 12:132170517-132170539 CCCCATCCCCCAATGTCCCCGGG + Intergenic
1105255949 13:18744252-18744274 CCCCAAGACACCCTGTCCTCAGG + Intergenic
1105433527 13:20358408-20358430 CCCTATGAGTCCATGTCCCCTGG - Intergenic
1106544321 13:30717120-30717142 CACCATGACCCAATGTCCCCGGG + Intronic
1107636729 13:42399560-42399582 CCACATGACCCCATGTCCAAAGG - Intergenic
1107707690 13:43123424-43123446 CTCCGCGTCCCCATGTCCCCAGG + Intergenic
1109259291 13:60124257-60124279 CTCTATGACCCCATTACCCCGGG + Intronic
1110656976 13:78011810-78011832 CAGCATAACCCAATGTCCCCTGG + Intergenic
1110821888 13:79926232-79926254 CCTCATGAGCCCATGCCACCAGG - Intergenic
1111230305 13:85336999-85337021 GCCAATGATCCCATGTACCCTGG + Intergenic
1112294238 13:98172431-98172453 CCTCATGACCTCACCTCCCCAGG + Intronic
1113422481 13:110181353-110181375 CCCGGTGGCCCCATGTCTCCAGG + Exonic
1116677125 14:47920203-47920225 CCTCATGAGCCCATGCCACCAGG - Intergenic
1116856287 14:49955218-49955240 CCCCATGAGGCCATGTGCTCTGG - Intergenic
1118486199 14:66216312-66216334 GCCCATGACCCCAAAACCCCGGG - Intergenic
1118729964 14:68659215-68659237 CCCCAGGGCCTCACGTCCCCAGG - Intronic
1119274375 14:73340276-73340298 CCCAGTGACCTCATGTCCCATGG + Intronic
1121241108 14:92430715-92430737 TCCCTTCACTCCATGTCCCCAGG + Intronic
1121818176 14:96944133-96944155 CTCCATGGCCCCTTCTCCCCCGG + Intergenic
1122119569 14:99544878-99544900 TCCCATGATCCCATGTCTCCGGG - Intronic
1122294632 14:100698291-100698313 CCGCATGGCCCCACGGCCCCTGG + Intergenic
1122347815 14:101071328-101071350 CCCCTAGACCCCATGTACCTTGG - Intergenic
1122606676 14:102951208-102951230 CCCCACGTCCCCATGACCGCTGG - Intronic
1122697471 14:103562985-103563007 CACCATGGCCCCACGCCCCCTGG - Exonic
1122716828 14:103701040-103701062 CCCCATGACCCCTCGGCCCCAGG + Intronic
1122821720 14:104349975-104349997 ACCCAGGACCCCATGTGCACTGG - Intergenic
1122960664 14:105092464-105092486 CCCCTTGTCCCCTTGTCCACTGG - Intergenic
1124606659 15:31174478-31174500 CCCTGGGACCCCATGTGCCCTGG - Intergenic
1126118324 15:45228911-45228933 TCCCATGCCCCCATTTCACCAGG + Intergenic
1127689724 15:61383586-61383608 TCCCATGCCCCCAAGTCCCACGG - Intergenic
1128000089 15:64183149-64183171 CCCCATGACCCAGAGTCACCAGG - Intronic
1128475134 15:67990987-67991009 CTCCCTGACCCCATTTCCACTGG + Intergenic
1129523799 15:76201667-76201689 CCCCAGCACCCCACCTCCCCAGG + Intronic
1130460771 15:84157108-84157130 CCCCAGGTCCCCATGGCTCCTGG - Intergenic
1130468709 15:84205570-84205592 CCCGATGGCCCCCTGTTCCCAGG + Intergenic
1130476199 15:84320121-84320143 CCCGATGGCCCCCTGTTCCCAGG + Intergenic
1130495566 15:84468009-84468031 CCCGATGGCCCCCTGTTCCCAGG - Intergenic
1130591002 15:85210169-85210191 CCCGATGGCCCCCTGTTCCCAGG + Intergenic
1130879430 15:88042464-88042486 CTGCAGGACCCCATGTGCCCCGG - Intronic
1131172784 15:90190469-90190491 CCCCATCACCTCAGGTCACCTGG - Intronic
1131520439 15:93110101-93110123 CCCCCAGACCCCCTGTCCCTGGG + Intergenic
1132224321 15:100128677-100128699 CCCCATTCCCCCAGGTCCCATGG - Intronic
1132580717 16:683535-683557 CCCCAGGACCCCACCTCCCTGGG - Exonic
1132600524 16:770717-770739 CCCCCTCACCCCATCCCCCCAGG - Intronic
1134102082 16:11459723-11459745 CCCCATGACCCCATGTCCCCAGG - Intronic
1134774172 16:16837610-16837632 GCACTTGACCCCATGTCACCAGG + Intergenic
1137727993 16:50669972-50669994 CCTCATGAGACCCTGTCCCCTGG - Intronic
1138185818 16:54976784-54976806 CCCCAGGACCCTATGTAACCAGG + Intergenic
1138301724 16:55936036-55936058 GCCCATGAGCCCATGTTCTCAGG + Intronic
1138786057 16:59847927-59847949 TCCCATGGCACCATGTCCCATGG - Intergenic
1139370874 16:66468794-66468816 CCCCAGGACCCCAGCTCCCAAGG + Intronic
1139548088 16:67659079-67659101 TCCCATGGTCCCCTGTCCCCAGG - Exonic
1140033926 16:71358923-71358945 CCCCTTCACCGCAGGTCCCCTGG - Intronic
1141676871 16:85522347-85522369 CCCCATAGCCCCCTGCCCCCAGG + Intergenic
1141871453 16:86789296-86789318 CCCCATGTCCCCAGGGCTCCTGG - Intergenic
1142353616 16:89590938-89590960 CCCACTGGCCCCATGTCCCTCGG - Intronic
1142552604 17:750344-750366 TCTCCTGACCCCATCTCCCCGGG + Intronic
1143169537 17:4919890-4919912 CCCCATGGCCACACTTCCCCCGG - Intergenic
1144670961 17:17132298-17132320 CCTCATTCCCCCATGGCCCCAGG - Intronic
1148805018 17:50259639-50259661 CCCCAGGACCCAACGTCCTCAGG - Intergenic
1149597671 17:57873778-57873800 CCCCATCACACCAGGTCCTCAGG + Intronic
1150600365 17:66645803-66645825 TCCCCTGACCCCCTGTCACCGGG - Intronic
1151701432 17:75744574-75744596 ATCGAAGACCCCATGTCCCCAGG + Intronic
1151713251 17:75818500-75818522 CCCCATGCCCACATGGGCCCCGG - Intronic
1151758396 17:76087585-76087607 CCCTCTAACCCCATGTCTCCAGG + Intronic
1152384868 17:79966440-79966462 CCCCAGGACCTCCTCTCCCCAGG + Intronic
1152583520 17:81179279-81179301 CCCCATTTCCCCACCTCCCCTGG - Intergenic
1152642559 17:81455245-81455267 ACCCACCACCCCATGCCCCCAGG + Exonic
1153449343 18:5209551-5209573 CCCAATGAGCCAATGTTCCCAGG - Intergenic
1154435085 18:14336436-14336458 CCCCAAGACACCCTGTCCTCAGG - Intergenic
1157116244 18:44865005-44865027 CCCCATGCCTCAATTTCCCCTGG + Intronic
1157291382 18:46412259-46412281 GCCCTTGACCCCATGGCCCCAGG - Intronic
1157322940 18:46647914-46647936 CCACATGACCCTATGGTCCCAGG - Intronic
1160101442 18:75923306-75923328 CCCCATTGCCAAATGTCCCCTGG + Intergenic
1160570035 18:79809919-79809941 CCCCACAACCCCATGAGCCCCGG - Intergenic
1160892631 19:1387358-1387380 CACCAGGACCCCAGGTCCTCCGG - Intronic
1161295811 19:3519737-3519759 CCCCAGGAGCCCCTGCCCCCAGG + Intronic
1161473430 19:4472538-4472560 CCCCATGAACCCCAGACCCCCGG - Intronic
1161588862 19:5119690-5119712 CCCGAAGACCCCAAGTTCCCTGG + Exonic
1161743837 19:6042707-6042729 CCCCATTGCCCCATCTCTCCAGG - Intronic
1162001449 19:7747042-7747064 GCCCCTGACCCCACCTCCCCAGG + Intronic
1163438942 19:17311907-17311929 CCCCCTGCCCCCATGTCTCGAGG + Intronic
1163485043 19:17580521-17580543 CCCCATGACCGCCAGACCCCTGG + Intronic
1163578065 19:18122143-18122165 CCCCATGACCCCCCACCCCCTGG - Intronic
1163710682 19:18845031-18845053 CCCCATGAGCACCTGTCCCTAGG + Intronic
1163845850 19:19637743-19637765 CCCCATGAGGTCCTGTCCCCTGG - Intronic
1165863472 19:38921651-38921673 CCCCAGGACCCCAAGTACCAGGG - Exonic
1166677528 19:44748787-44748809 CCCCATGCCCCGATGCCCCGCGG + Exonic
1166863296 19:45821821-45821843 GCCCATGACCCCCTGTGCCGCGG - Intronic
1166997459 19:46726538-46726560 CTCCATGCCCTCATCTCCCCTGG - Intronic
1167449803 19:49560447-49560469 TCCCATGACCCCATGTGGCCCGG - Intronic
1167456229 19:49597772-49597794 ACCCAGGACCCGATGGCCCCCGG + Exonic
1167592797 19:50413591-50413613 CCCCATGTCCCCGTGCCTCCTGG + Intronic
1167683896 19:50943497-50943519 GCCCCTGACCCCATGTCTCCTGG - Exonic
1167774351 19:51544984-51545006 CACGATCACCCCATGGCCCCAGG - Intergenic
1168189652 19:54728399-54728421 TCCCAGGACACCATGGCCCCAGG + Intronic
1168405283 19:56107469-56107491 CCCGGTGACCCCGTGTCTCCCGG - Intronic
1168405299 19:56107541-56107563 CCCTGTGACCCCGTGTCTCCTGG - Intronic
925185959 2:1846605-1846627 GCCCTTGACCACATGTCTCCCGG - Intronic
925231643 2:2238137-2238159 CCCCCTGACCCCATGTTCTCTGG - Intronic
925897617 2:8485186-8485208 CCCAATGACCCCAAGTGACCTGG + Intergenic
929555703 2:42924493-42924515 CCCGGTGCCCCCATTTCCCCTGG - Intergenic
931205417 2:60141122-60141144 CCCCACTAGCCCATGTCCCAGGG + Intergenic
931290222 2:60866320-60866342 CCCCATGTACCCCTGGCCCCAGG + Intergenic
932411216 2:71549119-71549141 CCCCAACACCCCATGAGCCCTGG - Intronic
932440409 2:71731255-71731277 GCCCATGACCCTCTGTCTCCCGG + Intergenic
933436605 2:82257484-82257506 CCTCATGAGCCCATGCCACCAGG - Intergenic
934490959 2:94761881-94761903 CCCCAAGACACCCTGTCCTCAGG + Intergenic
934950946 2:98575013-98575035 CCCCACAACCCCTTATCCCCAGG - Intronic
935767604 2:106384840-106384862 TCCCCTGACCGCATGTTCCCTGG + Intergenic
935930023 2:108113864-108113886 CCTCATGAGCCCATGCCACCAGG - Intergenic
936125606 2:109787112-109787134 GCCCATGGCCCCCTGGCCCCAGG - Intergenic
936219087 2:110584356-110584378 GCCCATGGCCCCCTGGCCCCAGG + Intergenic
936906080 2:117536914-117536936 CCCCAAGGCACCATTTCCCCAGG + Intergenic
937002939 2:118484709-118484731 CCCCATTAGCCCATGAGCCCTGG + Intergenic
940610566 2:155985931-155985953 CCTCAAGACCCCATGTGACCTGG - Intergenic
941649580 2:168079367-168079389 CTCAATGTCCCCATGTCCCCTGG + Intronic
941688026 2:168467878-168467900 TACCATGACCCCATGTCCTTGGG - Intronic
942555196 2:177165779-177165801 CCCCATGCCCTCATTTCCTCTGG + Intergenic
943119378 2:183715450-183715472 CCCCATGATCCCCTTTCCCTAGG + Intergenic
946153982 2:217794841-217794863 ACTGATGACCCCATGACCCCTGG + Intergenic
946241258 2:218357359-218357381 CCCCATGTCCCCATGTCCCCGGG - Intronic
946391739 2:219420366-219420388 CCCCATGGCCCAGTGACCCCAGG - Intronic
946442270 2:219706781-219706803 CCTCATGGCCCCAGGGCCCCAGG - Intergenic
946995275 2:225384104-225384126 ACACATGGCACCATGTCCCCAGG - Intergenic
947711927 2:232321431-232321453 CCACATGACATCATGGCCCCTGG - Intronic
947856748 2:233329239-233329261 CCCCATAACCTCCTGACCCCTGG + Intronic
948132250 2:235609339-235609361 CCCCATGTCCCCATGTCCTCTGG - Intronic
948502809 2:238407261-238407283 CCCTCTCACCCCAGGTCCCCTGG - Intergenic
948814227 2:240501780-240501802 ACCCATGCCCCCATGTGCCAGGG - Intronic
949027695 2:241774135-241774157 CCCCAGGGCCCCAGGGCCCCAGG - Intergenic
949063504 2:241975060-241975082 CCCCATGTGCCCACGTCCTCCGG + Intergenic
1169208329 20:3752295-3752317 TCCCATGACCTTATCTCCCCCGG - Exonic
1169282802 20:4281273-4281295 TCCCATGATCCAATTTCCCCAGG - Intergenic
1170046373 20:12089767-12089789 CCCACTGACCCCATTTCCCAGGG + Intergenic
1170430378 20:16270286-16270308 CCACAAGACCCCATTTCCTCAGG - Intergenic
1170764604 20:19279410-19279432 CCCCATGGCCCCATGAAGCCAGG + Intronic
1172229493 20:33327212-33327234 CCCCTTGACCCCCAGCCCCCAGG - Intergenic
1172285242 20:33735706-33735728 GTCCTTGACCCCATTTCCCCTGG + Intronic
1172382463 20:34506729-34506751 CCCCATGACTCCCTTTCCCCAGG + Intronic
1173626435 20:44476154-44476176 CCCCGAGACCCCATATCCCGTGG - Intronic
1175732023 20:61360627-61360649 CTCCATTGCCACATGTCCCCAGG - Intronic
1175825070 20:61932224-61932246 CCCCATGTCCTCCCGTCCCCAGG + Intronic
1176098363 20:63354159-63354181 CCCCAGGACCACAGGCCCCCAGG - Intronic
1176124586 20:63469810-63469832 CCTGATGGCCCCATGTCCTCTGG - Intronic
1176841951 21:13849266-13849288 CCCCAAGACACCCTGTCCTCAGG + Intergenic
1176991055 21:15496688-15496710 CCCCATTACCCCATAGCTCCGGG + Intergenic
1179059977 21:37970936-37970958 CCCCATCACCCCATGGTACCCGG + Intronic
1179394415 21:41024877-41024899 TCACATGACCCCTAGTCCCCAGG + Intergenic
1179875179 21:44263370-44263392 CCTGATGACCCCTTGGCCCCTGG + Intergenic
1179912846 21:44459540-44459562 ACGCATGACCCCAGGTCCCAAGG + Exonic
1179994207 21:44966561-44966583 CCCCATGGCCCCAAGCCCTCAGG + Intronic
1180064131 21:45404580-45404602 CCCCAGGTCCCCCTGTTCCCAGG - Intergenic
1180611302 22:17099994-17100016 CTCCATAGCCCCAAGTCCCCTGG + Intronic
1182553839 22:31118077-31118099 CCCCAGTACCCCATGGGCCCTGG + Intronic
1183387598 22:37524103-37524125 CCCCATTGCCCAGTGTCCCCCGG + Intergenic
1184230761 22:43157241-43157263 CCCCATGAGCACGTGTACCCTGG + Intronic
1185047700 22:48537261-48537283 CCTCATGTCCTCAGGTCCCCAGG - Intronic
1185048512 22:48541252-48541274 CCCCAGGACCCTATACCCCCTGG + Intronic
1185092774 22:48785293-48785315 GCCCATGACCCCCCGCCCCCGGG + Intronic
1185159788 22:49216606-49216628 TCCCATGACCTCCTCTCCCCTGG + Intergenic
949543576 3:5053396-5053418 ATCCATGACCCCATATCCTCAGG - Intergenic
951727630 3:25777473-25777495 CCTCAAGACCCCATGTGTCCTGG + Intronic
952574482 3:34758795-34758817 CCTCATGACCTCATGCCACCAGG + Intergenic
952759216 3:36899029-36899051 CCCCATGAGCCTGAGTCCCCAGG + Intronic
953869988 3:46618127-46618149 GCCCATGACTCCATGGCCACTGG + Intronic
953882709 3:46699984-46700006 CTCCCTGACCCCATGTCCCGAGG + Intergenic
953905760 3:46867601-46867623 CCCCACGTGCCCTTGTCCCCTGG + Intronic
954189255 3:48944833-48944855 CCACATCATCCCTTGTCCCCCGG + Intronic
954434592 3:50489456-50489478 CCCCATAGCCCCATCTTCCCTGG - Intronic
954502319 3:51029957-51029979 CCCCCCGACCCCGTGTCCCAGGG - Intronic
954682368 3:52352724-52352746 CACCCTGCCCCCATGCCCCCAGG + Intronic
961635577 3:128330703-128330725 CCCCCTGCCCCCTTGTGCCCAGG - Intronic
961657938 3:128453608-128453630 CCCCAGAACCCCACGACCCCAGG + Intergenic
962960885 3:140310014-140310036 CCCCATGACCAGATCTCCCTTGG - Intronic
963755932 3:149235169-149235191 CCTCATGAGCCCATGCCACCAGG + Intergenic
966573877 3:181477588-181477610 CCTCATGAGCCCATGCCACCAGG - Intergenic
968349935 3:198045822-198045844 CCCCAAGACACCCTGTCCTCAGG + Intergenic
968506920 4:974953-974975 CCCCAAGACCCCCTGTGCCTGGG + Intronic
968521101 4:1035197-1035219 CTCCCTGACCCCAGGTCCCTGGG - Intergenic
968610291 4:1554005-1554027 CCCCATGACCCACAGCCCCCTGG + Intergenic
968880943 4:3299866-3299888 GCCCATGACCCCTGGACCCCTGG + Intronic
973053133 4:45619675-45619697 CACAAAGACTCCATGTCCCCTGG - Intergenic
974539832 4:63219506-63219528 CCTCATGAGCCCATGCCACCAGG - Intergenic
984710484 4:182880219-182880241 TCCCAAGACCCCATGTCACTTGG + Intergenic
985733180 5:1563030-1563052 CCCCAGGACTCCTTGTTCCCAGG + Intergenic
987260134 5:16195050-16195072 CCCCATGAGCCCATGCCACCAGG + Intergenic
988110437 5:26812871-26812893 CCTCATGAGCCCATGCCACCAGG + Intergenic
988503008 5:31799170-31799192 CCACAGGGCCCCACGTCCCCTGG - Exonic
990236312 5:53771672-53771694 GGGCATGACCCCATATCCCCAGG + Intergenic
990358673 5:54996315-54996337 CCCCATGACCCCGTGATTCCTGG + Intronic
990539429 5:56757386-56757408 CTAAATGTCCCCATGTCCCCTGG - Intergenic
991357548 5:65784825-65784847 CCCCATTATCCCCTATCCCCAGG + Intronic
991972824 5:72157517-72157539 GCCCATGGCTCCCTGTCCCCGGG - Intronic
993493912 5:88586474-88586496 CCTCATGAGCCCATGTCACCAGG + Intergenic
993732607 5:91440384-91440406 CCCCATTTCCCTATTTCCCCTGG - Intergenic
995797939 5:115961812-115961834 CCCCACAACCCCATTTCACCCGG + Intergenic
997472612 5:134125131-134125153 CCCCATGACCCCTTCTTGCCTGG - Intronic
998402047 5:141853209-141853231 CCCCATCCCACCATGGCCCCAGG + Exonic
999131344 5:149285752-149285774 CCCCAAGGCCCCAGCTCCCCAGG + Intronic
999315605 5:150582198-150582220 CCCCAGGAACCCCTTTCCCCAGG + Intergenic
1001843898 5:174904080-174904102 CCTCATGAGCCCATGCCACCAGG + Intergenic
1001912335 5:175531344-175531366 CCCAATGACCACATGGCCCCCGG - Intergenic
1002526233 5:179817379-179817401 CCCCAAGTGGCCATGTCCCCCGG + Intronic
1003594928 6:7465926-7465948 CTCCCTGTGCCCATGTCCCCAGG - Intergenic
1004910764 6:20280597-20280619 CCCCAGGATCCCATATCCACAGG - Intergenic
1005920672 6:30397881-30397903 GCCCATGACCCCAGGGCCCCTGG - Intergenic
1007074042 6:39055626-39055648 CCCCTTCACCTCATGTCCTCAGG + Intronic
1007785928 6:44279285-44279307 CCCCACAAGCCCTTGTCCCCAGG - Exonic
1008625792 6:53315194-53315216 CCCCATGTCCCCAAGTCCCCAGG - Intronic
1009707176 6:67266610-67266632 CCTCATGAGCCCATGCCACCAGG - Intergenic
1010812425 6:80315274-80315296 CCTCATGAGCCCATGCCACCAGG - Intronic
1011401497 6:86967034-86967056 CCCCATGTACCCATGTGCCATGG + Intronic
1012901602 6:105012836-105012858 CCCTATGACCCCAGGTTCCATGG - Intronic
1013216493 6:108032347-108032369 GCCCATGACCCCAAAACCCCAGG + Intergenic
1013795991 6:113889506-113889528 TCCCATGACTCCATGACTCCAGG - Intergenic
1018108031 6:160507467-160507489 TCCCCTGACCCCATATTCCCTGG - Intergenic
1018128438 6:160704968-160704990 TCCCCTGACCGCATGTTCCCTGG + Intronic
1018238084 6:161745373-161745395 TTCCATGACCCCATGACTCCTGG - Intronic
1018831692 6:167448516-167448538 CCCCATGAGCCAGGGTCCCCGGG + Intergenic
1019512865 7:1426741-1426763 CCCCAGGACCCCATCAACCCAGG - Intergenic
1020279720 7:6644087-6644109 CCCTAGGACCCCATGGCCCCTGG + Intronic
1021776462 7:24059585-24059607 CCTCATGAGCCCATGCCACCAGG + Intergenic
1022520976 7:31006697-31006719 CCCCATCACCCCAGGCCCTCTGG + Intergenic
1022527565 7:31048419-31048441 CCCCATGGACCCTGGTCCCCAGG - Intergenic
1022574339 7:31482944-31482966 CCTCAGGTCCCCAGGTCCCCTGG - Intergenic
1023163047 7:37316524-37316546 GACCATGACACCATGTGCCCTGG + Intronic
1024589931 7:50872505-50872527 CCTCATGAGCCCATGCCACCAGG + Intergenic
1025847977 7:65217399-65217421 CCTCAGGACCCCACATCCCCCGG + Intergenic
1025898216 7:65723263-65723285 CCTCAGGACCCCACATCCCCCGG + Intergenic
1026019570 7:66697026-66697048 ACCCCTGACCCCATGCCCCAGGG + Intronic
1026510971 7:71027193-71027215 CCCCATGACCACAGGTAGCCCGG + Intergenic
1026678202 7:72446049-72446071 CCACAAGAACCCATGCCCCCGGG + Intronic
1027170219 7:75866569-75866591 CCCAATGCCCCAATTTCCCCAGG - Intronic
1029027870 7:97436872-97436894 CCTCATGACTGCATTTCCCCCGG + Intergenic
1029144220 7:98434349-98434371 CCTCAGGACCCCACTTCCCCCGG + Intergenic
1030314577 7:108101441-108101463 TTCCATGTCCCCATGTCCCATGG - Intronic
1032410181 7:131688989-131689011 CACCATGACCCCTTCTCCCTGGG - Intergenic
1033229014 7:139582419-139582441 CACCACGACCCCCTGCCCCCAGG + Intronic
1034417221 7:150971500-150971522 CTCCATGTCCCTGTGTCCCCGGG - Intronic
1035519532 8:266047-266069 CCCCCTGACCCCCCCTCCCCAGG - Intergenic
1039637159 8:39179569-39179591 CCTCATGAGCCCATGTCACCAGG - Intronic
1040105337 8:43538324-43538346 CCCCAAGACACCCTGTCCTCAGG - Intergenic
1040482702 8:47841279-47841301 CCCCAGGCACCCATGCCCCCAGG + Intronic
1046530509 8:115439019-115439041 CGCCACTACCCCATGTCCCAGGG - Intronic
1046657753 8:116913351-116913373 CCTCATGAGCCCATGCCACCAGG - Intergenic
1047796932 8:128267259-128267281 CACCATGAGCCCAGGTCCTCGGG - Intergenic
1048268112 8:133005269-133005291 CCCCCTGTCCCCCTGTCCCAGGG - Intronic
1049398759 8:142415401-142415423 CCCCATTAGCCCCTGTCCACCGG - Intergenic
1049446628 8:142634411-142634433 CCCCAAGAACCCACCTCCCCAGG + Intergenic
1050393058 9:5167267-5167289 CCTCATGAGCCCATGCCACCAGG + Intronic
1051459172 9:17293853-17293875 CCCAATGAGCCCATGCCACCAGG - Intronic
1052865759 9:33463831-33463853 CCTGATGTCCCCAGGTCCCCGGG + Exonic
1053667031 9:40323808-40323830 CCCCAAGACACCCTGTCCTCAGG - Intronic
1053916623 9:42948917-42948939 CCCCAAGACACCCTGTCCTCAGG - Intergenic
1054378178 9:64463836-64463858 CCCCAAGACACCCTGTCCTCAGG - Intergenic
1054517579 9:66052475-66052497 CCCCAAGACACCCTGTCCTCAGG + Intergenic
1054850436 9:69841995-69842017 CCCCATCACCCCCTATTCCCAGG + Intronic
1057675068 9:97131575-97131597 CCCCAAGACACCCTGTCCTCAGG + Intergenic
1059328326 9:113518254-113518276 CCCCATGGCCCCAGGTAGCCAGG - Intronic
1059510080 9:114836876-114836898 CCTCATGAGCCCATGCCACCAGG - Intergenic
1060367850 9:123037142-123037164 CCACTTTAACCCATGTCCCCTGG - Intronic
1060424379 9:123492450-123492472 TCCCATCACTCCAAGTCCCCTGG - Intronic
1060547373 9:124469263-124469285 CCCCATGACTACGTGGCCCCCGG + Exonic
1060547408 9:124469410-124469432 CCCACTGACCCCAGGTCTCCAGG + Exonic
1061003516 9:127915869-127915891 CCCCATCACCCCACCTGCCCCGG + Intronic
1061231511 9:129318554-129318576 TCCCAGGATCCCATGTTCCCTGG + Intergenic
1061238845 9:129357699-129357721 CCCCAGGAGGCCATGTCCCCAGG + Intergenic
1061503205 9:131015399-131015421 CCCTGTGGCCCCTTGTCCCCGGG + Intronic
1061828419 9:133275502-133275524 CCCCTTGACACCCTGTCTCCCGG + Intergenic
1061867276 9:133499327-133499349 CCCCAGGACACGCTGTCCCCTGG + Intergenic
1061942456 9:133891148-133891170 CCCCCTGCACCCTTGTCCCCCGG - Intronic
1061973792 9:134058290-134058312 CCCCTAGATCCCAAGTCCCCTGG + Intronic
1062080634 9:134621579-134621601 AGACATGGCCCCATGTCCCCTGG - Intergenic
1062176656 9:135166982-135167004 CCCCACGAGCCCAGGTCCACAGG - Intergenic
1062362583 9:136194666-136194688 CCCCATCACTCCCAGTCCCCAGG + Intergenic
1187667930 X:21635800-21635822 CTCCATAACCCCAACTCCCCAGG + Intronic
1188843749 X:35047748-35047770 CCCCAAATCCACATGTCCCCAGG + Intergenic
1189074990 X:37905739-37905761 CCCCAGGACCCCATGACCCCGGG - Intronic
1189200515 X:39191849-39191871 CACCATGTCCCTGTGTCCCCAGG + Intergenic
1189861500 X:45276661-45276683 CCTCATGAGCCCATGCCACCAGG - Intergenic
1189940202 X:46113147-46113169 CCCCATGAGACCATGCCACCAGG - Intergenic
1191034333 X:56008540-56008562 CCTCATGAGCCCATGTCACCAGG + Intergenic
1191842873 X:65525398-65525420 GCCCTTGACCCCATGATCCCAGG - Intronic
1192261591 X:69508921-69508943 CCAGGTGACCCCCTGTCCCCAGG + Intronic
1192822143 X:74656816-74656838 CCTCATGGGCCCATGTCACCAGG - Intergenic
1193164395 X:78264456-78264478 CCTCATGAGCCCATGCCACCAGG - Intergenic
1193647780 X:84089585-84089607 CCTCATGAGCCCATGCCACCAGG - Intronic
1196229350 X:113203065-113203087 CCTCATGAGCCCATGCCACCAGG - Intergenic
1196537855 X:116868413-116868435 CCTCATGATCCCATGCCACCAGG - Intergenic
1197083007 X:122441093-122441115 CCCAATGGCCCCAGGGCCCCAGG - Intergenic
1197767123 X:130066591-130066613 ACACTTGACCCCAAGTCCCCCGG - Exonic
1199173446 X:144757834-144757856 CCTCATGAGCCCATGCCACCTGG - Intergenic
1199500777 X:148503423-148503445 CCCCACGCCCCCAAGCCCCCAGG + Intronic
1199815345 X:151392338-151392360 GCCTAGGATCCCATGTCCCCTGG - Intergenic
1199851900 X:151729690-151729712 TGCCATGACCCCCTGTGCCCAGG - Intergenic
1201503745 Y:14674759-14674781 CTCCATGACCACATGGCACCTGG - Intronic