ID: 1134103442

View in Genome Browser
Species Human (GRCh38)
Location 16:11469139-11469161
Sequence GTGCAGACACAGGTGGGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 353
Summary {0: 1, 1: 0, 2: 4, 3: 44, 4: 304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134103437_1134103442 -6 Left 1134103437 16:11469122-11469144 CCCTGGGGAGGTGTCAGGTGCAG 0: 1
1: 0
2: 1
3: 29
4: 308
Right 1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG 0: 1
1: 0
2: 4
3: 44
4: 304
1134103438_1134103442 -7 Left 1134103438 16:11469123-11469145 CCTGGGGAGGTGTCAGGTGCAGA 0: 1
1: 0
2: 1
3: 26
4: 326
Right 1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG 0: 1
1: 0
2: 4
3: 44
4: 304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134103442 Original CRISPR GTGCAGACACAGGTGGGCCT AGG Intronic
900123797 1:1060637-1060659 GTGCAGACACAGAAGAGCCAGGG + Intergenic
900406930 1:2496864-2496886 CTGCAGAATCTGGTGGGCCTTGG - Exonic
900737330 1:4307365-4307387 GGGCAGACACAGAAGGGGCTTGG - Intergenic
900959459 1:5909873-5909895 GGGCAGGTACAGGTGGCCCTGGG - Intronic
901689953 1:10966347-10966369 GTGCAGAAAGAGGTGGGTTTGGG - Exonic
902585456 1:17436567-17436589 CTGGAGACAGAGGTGGGCCAGGG + Intronic
902603549 1:17556122-17556144 CTGGAAACACAGGGGGGCCTGGG + Intronic
902662784 1:17916964-17916986 GAGCAGACAGAGGGAGGCCTTGG - Intergenic
902722016 1:18310046-18310068 ATGCAGCCACAGGCGGGACTGGG - Intronic
903337980 1:22637585-22637607 GTGGAGACACGGGAGGGCCTGGG - Intronic
903375171 1:22861223-22861245 CTGCTCACACAGGTGGGTCTGGG + Intronic
904377040 1:30088183-30088205 GTGAGGACACAGGTGGTGCTGGG + Intergenic
905371592 1:37485387-37485409 GTGCAGAGACAGCGGGGGCTTGG - Intergenic
906128357 1:43441421-43441443 GTGAAGTCACAGATGGGCCTTGG + Intronic
907803118 1:57791240-57791262 GTTCCAACACAGGGGGGCCTAGG - Intronic
912454037 1:109785987-109786009 GTGCAGAAAGAGGTTGCCCTGGG + Intergenic
914247271 1:145895657-145895679 CTGGATGCACAGGTGGGCCTGGG + Exonic
914951161 1:152115556-152115578 GTGGAGACAGAGGTGGAGCTGGG - Intergenic
915733756 1:158071824-158071846 GTGCACACAAATGTGTGCCTAGG + Intronic
917614212 1:176721734-176721756 ATGCAAAGACAGGTAGGCCTTGG - Intronic
917737915 1:177937213-177937235 CTGCAGACACACCTGGGCCCTGG - Exonic
920674661 1:208030678-208030700 GAGCCGACACAGATGGGCCCAGG - Intronic
920719138 1:208370646-208370668 GTACAGACAGAGGAGGGACTAGG - Intergenic
921158316 1:212454918-212454940 GAGCTCCCACAGGTGGGCCTGGG - Intergenic
921998453 1:221447792-221447814 GAGGAGACACAGGTAGCCCTTGG + Intergenic
922252683 1:223864316-223864338 GTCCAGACACAGGATGGCGTGGG + Intergenic
922331670 1:224582334-224582356 GTGCAGAGACAGATGTGGCTGGG + Intronic
924421842 1:243917245-243917267 GTGCAGAAGCGGGTGGGCGTGGG - Intergenic
1065169697 10:23014184-23014206 ATTCAGACACAACTGGGCCTTGG + Intronic
1066979911 10:42403283-42403305 GTGGAGAAATAGGTGGGCCCAGG + Intergenic
1067087822 10:43252172-43252194 GTGCACACACAGGAGTGCCTGGG - Intronic
1067089024 10:43257319-43257341 GTCTAGACACAAGTGGGCCCAGG - Intronic
1067258693 10:44667162-44667184 GGGCAGCCATGGGTGGGCCTGGG + Intergenic
1067895028 10:50169541-50169563 GTGATTACAAAGGTGGGCCTAGG - Intergenic
1067953810 10:50770722-50770744 GTGATTACAAAGGTGGGCCTAGG + Intronic
1070212657 10:74342563-74342585 GAGGAGAATCAGGTGGGCCTAGG - Intronic
1071529894 10:86381043-86381065 CTGCAGCCACAGGTGGCCCAAGG - Intergenic
1072115502 10:92366742-92366764 GTGCAGAGACACCTGGGGCTGGG + Intergenic
1072781544 10:98255119-98255141 GAGAACACACAGCTGGGCCTTGG + Intronic
1074776817 10:116773189-116773211 GAGCAGGCCCAGGTGGGCCCAGG + Intergenic
1074782621 10:116812812-116812834 GCGCAGACACAGATGAGCTTTGG + Intergenic
1075023420 10:118967400-118967422 GTGGAGCCAAGGGTGGGCCTGGG + Intergenic
1076062769 10:127426664-127426686 GTGCAGACACAGGCATGCTTTGG + Intronic
1076469523 10:130708780-130708802 GGGGAGCCACAGATGGGCCTCGG - Intergenic
1076494972 10:130891090-130891112 CTGAAGTCACAGGTGGTCCTCGG + Intergenic
1076619317 10:131776921-131776943 GTGGAGACACAGGAAGGTCTCGG + Intergenic
1076702700 10:132282426-132282448 GTGCAGGTACAGGTGGGCGCAGG - Intronic
1076702712 10:132282474-132282496 GCGCAGGCACAGGTGGGCGCAGG - Intronic
1076702716 10:132282490-132282512 GCGCAGGCACAGGTGGGCGCAGG - Intronic
1076845906 10:133069470-133069492 GTGCAGAGCCAGGGGGCCCTGGG + Intergenic
1076846021 10:133069848-133069870 GTGCAGAGTCAGGGGGCCCTGGG + Intergenic
1076846043 10:133069914-133069936 GTGCAGAGTCAGGGGGCCCTGGG + Intergenic
1076870295 10:133189592-133189614 GTCCAGACACAGGTAGGCTGTGG - Exonic
1076903511 10:133351287-133351309 ATGCAGCCCCAGGTGGGCCTCGG + Intronic
1077095828 11:798581-798603 GGGCAGACACAGGTGATCCGTGG + Exonic
1077115028 11:880292-880314 GTGCTGGCTGAGGTGGGCCTGGG - Intronic
1077292313 11:1803572-1803594 GTCCAGACACAGGATGGCATGGG + Intergenic
1079032973 11:16999327-16999349 CTGCAGGCAGAGGAGGGCCTGGG - Intronic
1081570208 11:44286102-44286124 CTCCAGACACAGGAGGTCCTTGG + Intronic
1081795888 11:45819167-45819189 TTGCAGTCAGAGGTTGGCCTGGG + Intergenic
1083437580 11:62653198-62653220 GGGCAGGCCCAGGTGGCCCTGGG + Exonic
1083581656 11:63828869-63828891 GTGGGGGCACAGGTGGGACTTGG + Intergenic
1083628055 11:64082114-64082136 GCGCAGCCACAGGAGGGCCTGGG - Intronic
1084208816 11:67611516-67611538 GTGCAGGCACAGACAGGCCTGGG + Exonic
1084473702 11:69377142-69377164 GTGCGTTCACAGGTGGGCATGGG - Intergenic
1084473716 11:69377202-69377224 GTGCGTTCACAGGTGGGCGTGGG - Intergenic
1085309003 11:75505248-75505270 GGGCAAGCACAGATGGGCCTGGG + Intronic
1089197729 11:116704574-116704596 GTGAGTACACAGGTGGGCATAGG - Intergenic
1091226957 11:133963246-133963268 GGGCATACTCAGGTGGGCCAGGG - Intergenic
1091438202 12:490909-490931 CTGCAGACCCATCTGGGCCTGGG - Intronic
1093639341 12:21508088-21508110 CTGCAGACACAGATGCCCCTTGG + Intronic
1095108501 12:38264257-38264279 GTACAGTCACACGTGGGCTTAGG - Intergenic
1095943085 12:47739035-47739057 GTGCACACACAGATAGGCATGGG + Intronic
1096153929 12:49331421-49331443 GTGCAGCCACAGCTGGGCTGTGG - Intronic
1096242369 12:49966243-49966265 GTGGGGACACTGGTGGGCCAAGG - Intergenic
1101900618 12:108788951-108788973 GGGCAGACACCAGTGGCCCTGGG - Exonic
1102858291 12:116314055-116314077 GTGCAATCACAGGTGCGCCCAGG - Intergenic
1104290022 12:127457948-127457970 GGGCAGACCCACGTGGGCCCTGG + Intergenic
1104939884 12:132390085-132390107 GTGCAGGCACAGGAGTGCCAAGG - Intergenic
1105014778 12:132779796-132779818 GTGCACACACGTGTGTGCCTGGG - Intronic
1107423197 13:40268846-40268868 GTGCAGACACAGGAGGGCAGGGG - Intergenic
1108322285 13:49300849-49300871 GTGCACACACAGCTGCACCTGGG - Intergenic
1110500723 13:76224598-76224620 GTGAAGACACAGGGGGGCTCTGG + Intergenic
1114735820 14:25042835-25042857 GAGCTGACACAGTTGGCCCTTGG - Intronic
1115645197 14:35364411-35364433 GAGCAGCCACTTGTGGGCCTCGG - Intergenic
1117466752 14:56001524-56001546 GAACAGACACAGAAGGGCCTGGG - Intergenic
1117534457 14:56690333-56690355 GTGCAGACTCAGCTGGGTTTGGG + Intronic
1118648753 14:67867745-67867767 GTCCAGAAACAGCTGGGGCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121297126 14:92837361-92837383 GTGCAGACACAGGTGTGAGGGGG - Intronic
1122234342 14:100323465-100323487 GTGCAGACACTGCTGCTCCTGGG + Intronic
1122282891 14:100634654-100634676 CTGCTGCTACAGGTGGGCCTTGG - Intergenic
1124254112 15:28127229-28127251 CTGCAGACGCAGCTGGGCATAGG + Intronic
1124848827 15:33316394-33316416 GTGCAGACCCAGGCGGTCCTAGG + Intronic
1124959454 15:34383626-34383648 GTGCAGCCAGAGGTGGTCCTGGG - Intronic
1124976080 15:34529847-34529869 GTGCAGCCAGAGGTGGTCCTGGG - Intronic
1128502320 15:68235242-68235264 GTGTAGTCACAGGTGGACCTGGG + Intronic
1128513443 15:68327436-68327458 ATGAGGACAAAGGTGGGCCTGGG - Intronic
1128532519 15:68464421-68464443 TTGCAGACACAGGTGAGGCCAGG + Intergenic
1128683780 15:69669082-69669104 GAGCAGCCACAAGTGGGCCCTGG - Intergenic
1129245843 15:74278195-74278217 GGGCAGACACAGCTGAGCCTTGG + Intronic
1129327607 15:74809425-74809447 GGGGAGAAGCAGGTGGGCCTTGG + Intergenic
1129387969 15:75206414-75206436 GTGCTGCCAGTGGTGGGCCTGGG - Exonic
1129686629 15:77689659-77689681 GCGCAGGCAAAGATGGGCCTTGG - Intronic
1129701716 15:77772121-77772143 GTGCAGCCACAGGTGCTCCAGGG + Intronic
1131267300 15:90924262-90924284 CTGCAGACCCAGCTGGTCCTGGG - Intergenic
1132433085 15:101776076-101776098 GTACAGCCAGAGGTGGTCCTGGG - Intergenic
1132588605 16:716680-716702 ATGCACACAGACGTGGGCCTGGG - Intronic
1132714035 16:1281888-1281910 GTACAGACACAGATGTGCCTGGG + Intergenic
1132715200 16:1286577-1286599 GGGGAGAGACAGGTGGGTCTGGG + Intergenic
1132899209 16:2244223-2244245 GTGTTGAGAAAGGTGGGCCTCGG - Intronic
1133573345 16:7063715-7063737 GTGCAGACCCAGGTGTGTGTTGG - Intronic
1133889496 16:9865780-9865802 GTGCAGAAACAGCTTGCCCTTGG - Intronic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1135588877 16:23691274-23691296 GGCCATACTCAGGTGGGCCTGGG - Intronic
1136402937 16:30028364-30028386 GAACAGACACAGGGGGGCCTGGG + Intronic
1136548113 16:30966555-30966577 AAGCAGGCACAGATGGGCCTGGG + Intronic
1136682826 16:31977917-31977939 GTGCAGGGGCAGGTGGGCATGGG + Intergenic
1136783464 16:32921483-32921505 GTGCAGGGGCAGGTGGGCATGGG + Intergenic
1136886324 16:33932366-33932388 GTGCAGGGGCAGGTGGGCGTGGG - Intergenic
1139314488 16:66056716-66056738 GTGCAGAGACAGGAGGCCCATGG + Intergenic
1139665242 16:68450543-68450565 GGGGAGACCAAGGTGGGCCTAGG - Intergenic
1141499340 16:84432851-84432873 GTGCTAACACAGGTGGTCCAGGG + Intronic
1141990217 16:87605001-87605023 GTGCAGGCACAGGGAGGCCCGGG + Intronic
1142025482 16:87810625-87810647 CTGCAGCCCCAGGTGGACCTTGG + Intergenic
1142157201 16:88538000-88538022 GTGGGGAGACAGGTGGGCTTGGG - Intergenic
1142266964 16:89068403-89068425 GTCCAGCCACAGGTGGTTCTGGG + Intergenic
1203085776 16_KI270728v1_random:1183582-1183604 GTGCAGCCACAAGTGGTCCATGG + Intergenic
1203086114 16_KI270728v1_random:1185467-1185489 GTGCAGGGGCAGGTGGGCGTGGG + Intergenic
1143018377 17:3903864-3903886 GGCCAGACAGAGGGGGGCCTAGG - Intronic
1143282125 17:5762782-5762804 GTGCTGAAACTGGTGAGCCTTGG + Intergenic
1144029101 17:11304008-11304030 GTGCAGAAACAGTGAGGCCTGGG - Intronic
1144663635 17:17087559-17087581 GAGAAGACACAGGTTGGCCCTGG + Intronic
1144671363 17:17134402-17134424 GTGCAGGGACAGGTCGTCCTGGG + Intronic
1145061518 17:19737228-19737250 GAGCAGGCACAGGTGGGGCCAGG + Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1148159720 17:45443032-45443054 GTGCAGAAACAGGTGGTGGTGGG + Intronic
1149523579 17:57337043-57337065 GTGCAGACACAGGTAGCCTCTGG - Intronic
1150617678 17:66784821-66784843 CTGCTGACACAGGTGGCCGTCGG + Intronic
1151456481 17:74229259-74229281 ATTCTGACACAGGTGGGCCTGGG - Intronic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1151589069 17:75031606-75031628 GTCCAGACGCAGGCAGGCCTCGG - Intergenic
1151784884 17:76270555-76270577 GTGGGGACACAGGAGGGCCAGGG + Exonic
1151971329 17:77458989-77459011 GTGGGGACAGAGGAGGGCCTTGG + Intronic
1152062329 17:78086950-78086972 GTGCAGAGACAGGTGCGGCGGGG - Exonic
1152064556 17:78103529-78103551 GTGCAGAGACTTCTGGGCCTTGG - Exonic
1152239284 17:79153120-79153142 GGGCAGACACAGCTGGACCAGGG - Intronic
1152387516 17:79983759-79983781 GTTCAGACACAGGGGGCGCTGGG + Intronic
1152472517 17:80498374-80498396 GTGCCGACACAGGCCGGCCGGGG + Intergenic
1152656218 17:81520226-81520248 GTGGGGACACAGGAAGGCCTAGG + Intronic
1152946678 17:83201553-83201575 GTGCACACACAAGTGTGCATGGG - Intergenic
1153109581 18:1568568-1568590 GTGCAGCCACAGGTTAGCCATGG + Intergenic
1153597268 18:6740486-6740508 GTCCAGACTAAGATGGGCCTAGG - Intronic
1153880586 18:9418513-9418535 GCACAAACACAGGTGGGCCATGG + Intergenic
1154105374 18:11518224-11518246 GTGCAGACACAGTAGGGCCATGG + Intergenic
1155447027 18:25923070-25923092 GTGGAGACACAAGTGGGCCCAGG - Intergenic
1157753106 18:50195281-50195303 GCGCAGGCACAGGTGCGCCCCGG + Intergenic
1158402346 18:57132465-57132487 GTGCAGGCACAGGTGTCCATAGG - Intergenic
1158625510 18:59068056-59068078 ATGCAGCCACAGGGGGGCGTTGG - Intergenic
1160345794 18:78130814-78130836 GTGCACACACAGGTGGATTTGGG + Intergenic
1160962456 19:1729644-1729666 GTGCAGACACTGGTGTGCACCGG - Intergenic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1165136219 19:33671372-33671394 AGGCAGAAACAGGTTGGCCTGGG - Intronic
1165416924 19:35700242-35700264 GTGCAGACACACATGGTCCCAGG - Intergenic
1165472568 19:36011652-36011674 TGGTAGACACAGGTGGGCTTTGG - Intronic
1166126938 19:40720594-40720616 GAGCAGACAAAGCTGGGCCATGG - Intronic
1166720296 19:44992548-44992570 GTCCACAGCCAGGTGGGCCTGGG - Intronic
1167410414 19:49340798-49340820 GAGCAGAGCCAGGTGGGCCCTGG - Exonic
1168098642 19:54129191-54129213 GGCCAGACCCAGGTGGGGCTGGG + Intronic
925166574 2:1719342-1719364 GCACAGACCCAGGAGGGCCTGGG - Intronic
925579132 2:5392450-5392472 GTTCAGACACTGGTGATCCTTGG - Intergenic
926083866 2:10009319-10009341 GTGCAGGCAGAGGTGGGCAAGGG - Intergenic
927444609 2:23148014-23148036 GTGAAGACACAGGTCTGGCTAGG - Intergenic
928091615 2:28378067-28378089 CTGCACACACAGGTGTGCCAGGG + Intergenic
928230253 2:29492543-29492565 GTGCAGAAACAGCTAGGCCCTGG - Intronic
930887006 2:56337563-56337585 GTGGAGCCACAGATGGACCTGGG - Intronic
931699651 2:64899319-64899341 GTGCCGACAAAGGTGGGCTGTGG + Intergenic
933261942 2:80140904-80140926 TTGCAGACACATTTGTGCCTGGG - Intronic
934123149 2:88859638-88859660 GGGCAGACACAGGGTGGCCACGG + Intergenic
934686017 2:96322098-96322120 CTACAGAAACAGGTGCGCCTAGG - Intergenic
935962198 2:108436861-108436883 GGGCCGACAGAGGTGGGCCCAGG - Intergenic
936154039 2:110036803-110036825 GGGAAGCCACAGGTGGCCCTGGG - Intergenic
936190645 2:110334612-110334634 GGGAAGCCACAGGTGGCCCTGGG + Intergenic
937337217 2:121069374-121069396 CTACAGACCCAGGTGGGCCCTGG + Intergenic
937497092 2:122432085-122432107 GTGCTGACACAGGGTGTCCTGGG + Intergenic
938081632 2:128373394-128373416 GAGCAGCCCCAGGAGGGCCTTGG - Intergenic
938117118 2:128609561-128609583 GTGCAGACAGATCTAGGCCTGGG - Intergenic
938117122 2:128609583-128609605 GTGCAGACAGATCTAGGCCTGGG - Intergenic
938117126 2:128609605-128609627 GTGCAGACAGATCTAGGCCTGGG - Intergenic
938321731 2:130370771-130370793 GTGCAGACAGAGGTGAACCCTGG + Exonic
945250410 2:207761277-207761299 TTGCAGAAATAGGTGGGCCCAGG - Intronic
947433707 2:230053881-230053903 GAGCAATCACAGGTGAGCCTTGG + Intronic
948370753 2:237487662-237487684 GTGCAGGCACGGGTGGGAGTGGG + Intronic
948629603 2:239293586-239293608 GTCCATAAGCAGGTGGGCCTCGG - Intronic
948768544 2:240235645-240235667 GCCCAGACACAGGGCGGCCTCGG - Intergenic
948795246 2:240399232-240399254 GGGCAGAGAGAGGTGGGGCTGGG - Intergenic
948807866 2:240460757-240460779 GTAGGGGCACAGGTGGGCCTTGG - Intronic
1169475795 20:5930166-5930188 GTGCAGACAGAGGTGGCAGTGGG - Intergenic
1171457998 20:25282723-25282745 GTGCAGTCTGAGATGGGCCTGGG + Intronic
1172215756 20:33234545-33234567 GTGAAGACACAGGAAGGCCAAGG - Intergenic
1172271957 20:33659874-33659896 CTTCTGACACAGGTGCGCCTGGG - Exonic
1172408194 20:34704517-34704539 GTCCCGACCCGGGTGGGCCTGGG + Intronic
1172477942 20:35252851-35252873 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172477956 20:35252889-35252911 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172477971 20:35252927-35252949 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172477985 20:35252965-35252987 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172477999 20:35253003-35253025 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172478013 20:35253041-35253063 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172478027 20:35253079-35253101 GGGCAGGCTCAGGTGGGGCTGGG + Intronic
1172520766 20:35564048-35564070 GTAGGGACACAGCTGGGCCTGGG + Intergenic
1172610376 20:36246617-36246639 GCACAGACACAGGAGGGCCACGG + Intronic
1172620051 20:36312820-36312842 GGGCAGACAGAGGTGGGTCCGGG + Intronic
1172909733 20:38399087-38399109 GTGTAGACAGAGCTGGGCGTGGG + Intergenic
1173985546 20:47258964-47258986 GGGGAGACACAAGAGGGCCTCGG + Intronic
1175387322 20:58605543-58605565 GTGCAGAGTCAGGCGGTCCTGGG + Intergenic
1175544633 20:59770459-59770481 GTGGAGACTCAGTTGGGCCAGGG - Intronic
1175546130 20:59778954-59778976 GTGCAGACAGCGGTGGGCCTGGG - Intronic
1176139640 20:63539334-63539356 GTGCAGAGACAGGTGGCCCCGGG - Intergenic
1176254734 20:64146067-64146089 GTGCTGACACTGGGGGTCCTGGG - Intergenic
1176265738 20:64208406-64208428 GAGCAGAGCCAGCTGGGCCTGGG + Exonic
1180149301 21:45939630-45939652 GTGCAGACACCGCTGGGCCATGG + Intronic
1180247497 21:46557914-46557936 CTGCAGAGACAGGTGGGCCGTGG - Intronic
1181013214 22:20054210-20054232 GTGCAGACCCATGTGGGGCAGGG - Intronic
1181049599 22:20232296-20232318 GGGCAGACAGTGGGGGGCCTGGG - Intergenic
1181128138 22:20713648-20713670 GTGAAGACCCAGGTGTGCCTGGG + Intronic
1181167764 22:20992628-20992650 GTACAGACACAGGTGGGACCTGG - Intronic
1181882525 22:25992327-25992349 ATGCAAACACACGTTGGCCTTGG - Intronic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184558800 22:45249009-45249031 GAGCAGAGCCAGGTGGGACTGGG + Intergenic
1184629125 22:45762480-45762502 GTGCAGACACAGGTTCGGCTAGG - Intronic
1184943117 22:47783058-47783080 GTGCTCACTCAGGGGGGCCTTGG + Intergenic
1185231946 22:49688508-49688530 GTGCAGACCAAGGAGGTCCTGGG + Intergenic
1185370303 22:50457792-50457814 TTGCAGAAGCAGGTGAGCCTGGG - Intronic
950668984 3:14513936-14513958 GAGGATACACAGGTGGGCCAGGG - Intronic
953905830 3:46867846-46867868 GTGGACACACAAGTGGGCCCTGG - Intronic
954327548 3:49871764-49871786 ATGCAGACACACGTGCCCCTGGG - Intergenic
955903017 3:63777345-63777367 GTGCTGAGATAGGTGGGCATGGG - Intergenic
956167124 3:66405411-66405433 GTGAAGAGACACGTGGCCCTGGG + Intronic
956820390 3:72948898-72948920 GTGCAGACACAGGGAGCCCAGGG + Intronic
957053306 3:75426420-75426442 ATGCAGGCCCAGGTGGGCGTGGG + Intergenic
961108201 3:124260315-124260337 GTGCTGCCACATTTGGGCCTGGG - Intronic
961427361 3:126858593-126858615 AGGCAAACACAGGTGGGCCTGGG - Intronic
961545641 3:127630927-127630949 GGGCAGTTACAGCTGGGCCTGGG - Intronic
962912569 3:139866858-139866880 ATGCAGACACAGGAGGACCCAGG + Intergenic
962975410 3:140441879-140441901 GTGCAGACATATGTGAGGCTCGG - Intronic
964692707 3:159469572-159469594 GTGCAGGAGCAGGCGGGCCTTGG + Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
965622584 3:170655919-170655941 GTGCAGCCTCAGGAGGGCCCTGG + Intronic
966237986 3:177724169-177724191 GTGCAGACACTGCTGTTCCTTGG - Intergenic
968568301 4:1326582-1326604 AGGCAGACACATGTGGGACTTGG + Intronic
968609062 4:1548949-1548971 GTTCAGACACAGGTCGGGCGAGG + Intergenic
968964097 4:3760753-3760775 GGGCAGGCAGAGGTGGGGCTCGG + Intergenic
969517039 4:7653675-7653697 GTGCAGGCGCAGGTGGGCTGGGG - Intronic
971198177 4:24488964-24488986 GTGCATCCAGAGATGGGCCTGGG - Intergenic
972412641 4:38808287-38808309 GTGCAGAAAGAGGTAGGCATGGG + Intronic
975728462 4:77315397-77315419 GTGTAAACACAGTTGGGCTTGGG + Intronic
977069987 4:92373413-92373435 GGGCTGACACAGCTGGGCCATGG - Intronic
980806000 4:137814328-137814350 GGGCAGACCCAGTTGAGCCTGGG - Intergenic
984771531 4:183440849-183440871 CTGCAGACATAGGTGTGGCTGGG - Intergenic
985558424 5:569464-569486 GTGCACACCCAGGTGGGGCCAGG + Intergenic
985683825 5:1271367-1271389 CTGCAGACACACATGGGCTTAGG + Intronic
986788895 5:11141668-11141690 GTGCAGACACAGCTGGCCTAAGG - Intronic
990003824 5:50922891-50922913 GTTCAGACACAGGTCGGGCGAGG - Intergenic
991667575 5:69014519-69014541 TTGAAGACAGAGGTGGGGCTGGG - Intergenic
995558274 5:113353281-113353303 GGCCAGACACAGGAGGGTCTGGG + Intronic
996926423 5:128832256-128832278 GTGCACACACAGATTAGCCTAGG - Intronic
997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG + Intergenic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
1000041383 5:157487539-157487561 GTGCAGACACAGGTGTTTCCTGG - Intronic
1001547332 5:172578831-172578853 GTGCAGACACAGGCAGGGCCTGG + Intergenic
1002660419 5:180787791-180787813 GTGAAGGCTCAGGAGGGCCTTGG + Intergenic
1002915691 6:1526185-1526207 GTGGACAGACAGGTGGGGCTGGG - Intergenic
1003163751 6:3658264-3658286 GGGCAGACTCTGATGGGCCTAGG + Intergenic
1003486163 6:6581415-6581437 GTGCAGACTCAGCTGGGGCCAGG - Intergenic
1006915624 6:37592005-37592027 GGGCACACACAGCTGGGCCGGGG + Intergenic
1013009445 6:106106366-106106388 GTGCACTCTCAGGTGGACCTGGG - Exonic
1013805525 6:113992127-113992149 TTGCAGAGAAAGGGGGGCCTGGG + Intronic
1016323144 6:142870115-142870137 CTGCAGACCCAGGTGGGTCTTGG - Intronic
1017048435 6:150368916-150368938 ATGCAGACACAGGTGTGCCAGGG - Exonic
1017477827 6:154816202-154816224 GTGGAGACACAGCTGGACTTAGG + Intronic
1018512575 6:164541076-164541098 GTGAAGACACAGGTGGAGATTGG - Intergenic
1018662978 6:166105432-166105454 GAGCAGACACAGGTGGAGGTAGG + Intergenic
1019067419 6:169313862-169313884 GTGTGGACAGAGGTGGGCATTGG - Intergenic
1019067452 6:169314166-169314188 GTGTGGACAGAGGTGGGCGTTGG - Intergenic
1019067492 6:169314526-169314548 GTGTGGACAGAGGTGGGCATTGG - Intergenic
1019067504 6:169314624-169314646 GTGTGGACAGAGGTGGGCATTGG - Intergenic
1019067527 6:169314807-169314829 GTGTGGACAGAGGTGGGCATTGG - Intergenic
1019067544 6:169314938-169314960 GTGTGGACAGAGGTGGGCGTTGG - Intergenic
1019067657 6:169315923-169315945 GTGCAGACACAGGAGGGTGTTGG - Intergenic
1019306450 7:337590-337612 TTGCAGACACAGGTGGGCATGGG - Intergenic
1019712410 7:2523699-2523721 GTGCTGGCACAGGTGGGCTGTGG + Intronic
1022423434 7:30245954-30245976 GGGCAGCCATAGGTGGGCCCAGG + Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023980764 7:45068737-45068759 GAGCAGAGAGAGGTGGGGCTGGG - Intronic
1024608867 7:51046046-51046068 GTGCAGAAGCAGGTGGGGGTGGG + Intronic
1024786334 7:52911593-52911615 GGGCAGCCACAGCTGTGCCTGGG + Intergenic
1032403427 7:131639310-131639332 ATGCAGACAGGGGTGGGGCTAGG - Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1033165528 7:139035836-139035858 GTGGAGACGCAGGAGGGCCTCGG - Exonic
1034958820 7:155351668-155351690 GTGCAGACCCAGGAGGGCCCTGG - Intergenic
1035607471 8:939180-939202 GTGCAGACACAGAGGGGCTGGGG + Intergenic
1035607495 8:939256-939278 GTGCAGACACAGAGGGGCTGGGG + Intergenic
1035607520 8:939332-939354 GTGCAGACACAGGGGGGCTGGGG + Intergenic
1035607532 8:939371-939393 GTGCAGACACAGAGGGGCTGGGG + Intergenic
1035607568 8:939484-939506 GTGCAGACACAGAGGGGCTGGGG + Intergenic
1035607642 8:939710-939732 GTGCAGACACAGGGGGGCTGGGG + Intergenic
1035708223 8:1693956-1693978 ATGCAGACTCGGGTGAGCCTAGG + Intronic
1037825330 8:22156985-22157007 GTGCAGAGACAGGTGAGCACCGG - Intronic
1038149334 8:24928306-24928328 GGGCAGCCACGAGTGGGCCTAGG - Intergenic
1039445141 8:37625138-37625160 GAGGAGACACATGTGGGCCGTGG - Intergenic
1041449685 8:57994247-57994269 GTGCGGACATAGGTGGGAGTGGG + Intergenic
1046298454 8:112254286-112254308 GTGAAAACCCAGGTGTGCCTCGG - Exonic
1047297868 8:123587373-123587395 GAGAAGAGACAGGTGGGCCCAGG + Intergenic
1047643180 8:126842576-126842598 GTGAAGACACATGTGTGTCTGGG + Intergenic
1048327972 8:133453269-133453291 GTGCAGAAGCAGATGGGCCTTGG + Intergenic
1049105636 8:140610709-140610731 GTGCAGAGACAGTGGGGCCCAGG - Intronic
1049229846 8:141476278-141476300 CTGCAGAGGCAGGTGGGCCAGGG - Intergenic
1049339287 8:142103377-142103399 GTGCAGGCACAGGTGGACCTAGG - Intergenic
1049548912 8:143247277-143247299 GTGCAGAGCTAGGTCGGCCTCGG - Exonic
1049595140 8:143479997-143480019 TTTCAGAGACAGGAGGGCCTGGG - Intronic
1049709480 8:144057197-144057219 GCACATCCACAGGTGGGCCTGGG - Exonic
1055404695 9:75962371-75962393 GTGCAGATCCAGCTGGGCCAGGG + Intronic
1056434018 9:86557584-86557606 GTGCAGGCACATGGGGACCTTGG + Intergenic
1056453723 9:86740601-86740623 TTCCAGGCACAGGTCGGCCTTGG - Intergenic
1056798727 9:89676668-89676690 GTGCAGCCACAGGTTGGCACGGG - Intergenic
1057159341 9:92875684-92875706 GTGCAGAAACAGGTGTGCCTAGG - Intronic
1058670842 9:107359334-107359356 GGGCTGGCACAGGTGGCCCTGGG + Intergenic
1059571711 9:115444723-115444745 GTGCAGACACAGGAGTTCCATGG + Intergenic
1061053735 9:128210802-128210824 GTGCACACATGGGTGGGACTGGG - Intronic
1061230592 9:129313570-129313592 GTCCCAACACAGGTGGGCCGTGG + Intergenic
1062004203 9:134231139-134231161 CTGCAGACACAGGCGGACCTGGG + Intergenic
1062067628 9:134537299-134537321 GTGCAGACCCAGGAGGCCGTAGG + Intergenic
1062081310 9:134625185-134625207 CTGCAGAGTCAGGAGGGCCTGGG - Intergenic
1062088260 9:134659808-134659830 GTGCACACACAGCTGGGCACAGG - Intronic
1062179378 9:135182787-135182809 GTGGAGGGACAGGTGGGCCGAGG + Intergenic
1062452913 9:136623006-136623028 GTGCAGAGACTGGGTGGCCTAGG + Intergenic
1186206402 X:7205041-7205063 GTACACACACTGGTGGGCTTGGG + Intergenic
1186858919 X:13652286-13652308 CGGCAGTCACAGCTGGGCCTTGG + Intergenic
1187888266 X:23909003-23909025 TGGCAGTCACAGCTGGGCCTTGG - Intronic
1190801682 X:53795077-53795099 ATGCAGACAAAGGAGGGCATGGG + Intergenic
1197278903 X:124512139-124512161 ATGCAGACACAGGCGGACATCGG + Intronic
1197915669 X:131531781-131531803 GTGCAGATAGAGATGGGCCAAGG - Intergenic
1199037056 X:143063958-143063980 GTACAGCAACAAGTGGGCCTTGG + Intergenic
1200119957 X:153785516-153785538 GTGGAGCCACAGCCGGGCCTAGG - Exonic
1200684979 Y:6250051-6250073 GTGCAGACACACGTGTTCCTGGG - Intergenic
1200990509 Y:9341321-9341343 GTGCAGACACACGTGTTCCTGGG - Intergenic
1200993171 Y:9361638-9361660 GTGCAGACACACGTGTTCCTGGG - Intronic
1200995825 Y:9381909-9381931 GTGCAGACACACGTGTTCCTGGG - Intergenic
1200998489 Y:9402261-9402283 GTGCAGACACACGTGTTCCTGGG - Intergenic
1201000999 Y:9470791-9470813 GTGCAGACACACGTGTTCCTGGG - Intronic
1201003666 Y:9491119-9491141 GTGCAGACACACGTGTTCCTGGG - Intergenic
1201006322 Y:9511400-9511422 GTGCAGACACACGTGTTCCTGGG - Intergenic
1201008980 Y:9531710-9531732 GTGCAGACACACGTGTTCCTGGG - Intergenic