ID: 1134104411

View in Genome Browser
Species Human (GRCh38)
Location 16:11475777-11475799
Sequence CACCTTGAGCTGCCAGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 318
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 293}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134104411 Original CRISPR CACCTTGAGCTGCCAGAGCT TGG Intronic
900120775 1:1047809-1047831 CACCTGGATCTGCCGGAGCAGGG - Exonic
900767645 1:4515846-4515868 CTCCTGGAGCCGCCAGAGCCTGG + Intergenic
902191712 1:14767848-14767870 GACCTTGAGCTGCCAGAATGTGG + Intronic
902942951 1:19813735-19813757 CACATTTAGCTGGCAGAGATGGG - Intergenic
904134037 1:28297211-28297233 CACCTAGTGCTGGCAGGGCTGGG - Intergenic
904541827 1:31238812-31238834 CACCAGGAGCTGCCAGATCCTGG - Intronic
905011898 1:34753063-34753085 CACCTTGTTCAGCCACAGCTGGG - Intronic
905319532 1:37105996-37106018 CTCCTTCACTTGCCAGAGCTGGG - Intergenic
906670827 1:47653331-47653353 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
907756335 1:57314343-57314365 CAGCTTCAGCTGACAGAGCCTGG - Intronic
907821097 1:57970282-57970304 CACCTAGAGGTGAGAGAGCTTGG + Intronic
909003202 1:70243798-70243820 CACCTTGGCCTCCCAGAGTTGGG - Intronic
910589956 1:88919587-88919609 CGCCTAGAGCTGCCTCAGCTAGG - Intergenic
912209444 1:107542609-107542631 GCCCTTGAGCTTCCAGAGCAAGG - Intergenic
914392402 1:147234200-147234222 CAGCGTGGGCTCCCAGAGCTCGG + Intronic
915047714 1:153032506-153032528 AACCTTGGGCTGGCAGGGCTCGG - Exonic
915464060 1:156085765-156085787 CACCATGCCCTGCCAGACCTTGG - Intronic
917863564 1:179171759-179171781 CACCTTGGCCTCCCAGTGCTGGG + Intronic
918770086 1:188545984-188546006 CACCCTGAGCTGCCTGAGATAGG + Intergenic
919567766 1:199210011-199210033 CACCTGGACCTGTCAGAGGTGGG - Intergenic
919792542 1:201301289-201301311 CATCCTGGGCTGCCAAAGCTTGG - Intronic
922775328 1:228211864-228211886 CACCCTCAGCTGCCAGATCGTGG + Exonic
923429394 1:233905582-233905604 GTACTTGAGCTGCCGGAGCTGGG - Exonic
923885471 1:238150521-238150543 CACCCTCAGATGGCAGAGCTAGG - Intergenic
924269077 1:242313903-242313925 CACCTTGAGATAACAGAACTTGG + Intronic
924710620 1:246527616-246527638 CTCTGTGAGCTGACAGAGCTTGG - Intergenic
1062805668 10:417841-417863 CACCTGCACCTGTCAGAGCTCGG + Intronic
1062805739 10:418138-418160 CACCTGCACCTGTCAGAGCTCGG + Intronic
1064622532 10:17229820-17229842 GCCCTTGAGCTGCTCGAGCTCGG - Exonic
1064626489 10:17266742-17266764 CAGCTGGAGCTGGCACAGCTAGG - Intergenic
1064628146 10:17282575-17282597 CAGCTGGAGCTGGCACAGCTAGG - Intergenic
1066715824 10:38284866-38284888 CACCTTGAGATAACAGAACTTGG - Intergenic
1067018748 10:42776704-42776726 CACACTGAGCTCCCAGATCTCGG - Intergenic
1067466701 10:46504411-46504433 CATCTTGTGATGACAGAGCTGGG - Intergenic
1067620487 10:47880194-47880216 CATCTTGTGATGACAGAGCTGGG + Intergenic
1070462537 10:76684211-76684233 CCTCTTGAGCTGCCTGGGCTAGG - Intergenic
1071857598 10:89641935-89641957 CATCTTGAACTGCTGGAGCTAGG - Intronic
1072232824 10:93427282-93427304 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1073242477 10:102067292-102067314 CACCTAGCACTGCCAGAGCTCGG - Exonic
1075579111 10:123603475-123603497 AACCTGGGGCTGGCAGAGCTTGG - Intergenic
1077325067 11:1960160-1960182 TACCTGGAGCTGCCAGGGCATGG - Intronic
1078634231 11:13033910-13033932 CCCCTTGAGCTGTCAGAGCATGG + Intergenic
1080040389 11:27753918-27753940 CACCATGAGCTGCATGACCTTGG - Intergenic
1080692797 11:34572948-34572970 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
1080937683 11:36881303-36881325 CAACTGCAGCTGCCACAGCTCGG - Intergenic
1082009209 11:47438914-47438936 CAGCTTGAGCTGGCTCAGCTGGG + Exonic
1082185424 11:49174810-49174832 CACTTTGCACTCCCAGAGCTTGG + Intronic
1082295686 11:50439164-50439186 CACATTGAGGTGCCAGATATCGG - Intergenic
1083983979 11:66198161-66198183 CGCCTTGACCTCCCAGTGCTGGG + Intronic
1084573331 11:69973202-69973224 CAGAGTGAGATGCCAGAGCTGGG - Intergenic
1085071137 11:73547034-73547056 CACCTTGGCCTCCCAGTGCTAGG - Intronic
1085280615 11:75327835-75327857 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1085510962 11:77088008-77088030 CACCCTGAGCTCCCAGGCCTGGG - Intronic
1085623442 11:78054467-78054489 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1085767448 11:79295463-79295485 CACTTTGAGCTGGGAGAGCTGGG - Intronic
1085870281 11:80341408-80341430 CAGTTTGAGAAGCCAGAGCTGGG + Intergenic
1086680904 11:89670535-89670557 CACTTTGCACTCCCAGAGCTTGG - Intergenic
1087792634 11:102423049-102423071 CACCTTTAGCAGCTTGAGCTAGG - Intronic
1088918038 11:114241946-114241968 TAGCTTTAGCTTCCAGAGCTCGG + Intronic
1090112643 11:123931183-123931205 CACTTTGAGCTGACACAGCAAGG + Intergenic
1091291444 11:134442484-134442506 CACCCTGAGATGCCACAGCGGGG + Intergenic
1202808049 11_KI270721v1_random:15339-15361 TACCTGGAGCTGCCAGGGCATGG - Intergenic
1091789876 12:3265848-3265870 CACATGGAGCTGACAGAGCTGGG - Intronic
1092146343 12:6217271-6217293 CACCTTGGCCTCCCAAAGCTTGG - Intronic
1092503092 12:9066434-9066456 CACCTGGAGCTGCCCAACCTGGG + Intergenic
1093399462 12:18727095-18727117 CACCTTGACTTCCCAAAGCTTGG - Intronic
1094324385 12:29220982-29221004 CACATTGGGCTGCCAGCGCTTGG + Intronic
1095218614 12:39580259-39580281 CATCTTGAGATGTCAGAACTGGG + Intronic
1095443743 12:42264414-42264436 CACCTTCACCTCCCAAAGCTAGG + Intronic
1096144749 12:49270730-49270752 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1096968104 12:55644600-55644622 CTCCTTGAGCTACCAGAGTCAGG + Intergenic
1097798559 12:63888853-63888875 CACCCCAAGCTGCCACAGCTGGG + Intronic
1100361383 12:93882820-93882842 CAGCTTGAGATTCCAGAGTTAGG + Intronic
1101912071 12:108867386-108867408 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1102555340 12:113723134-113723156 TACCTTGGGCTCCCAAAGCTTGG + Intergenic
1103433718 12:120908307-120908329 CACCTGGGGCTGCTATAGCTTGG - Intergenic
1104040266 12:125125376-125125398 CACCGTCAGGTGCTAGAGCTGGG + Intronic
1104611711 12:130234536-130234558 CTCTTTGAGCTCTCAGAGCTGGG - Intergenic
1104802540 12:131564375-131564397 CTCCTGGAGCTGACAGAGCCGGG - Intergenic
1105470741 13:20692478-20692500 CACCTTGGCCTCCCAGAGCTGGG + Intergenic
1105862981 13:24433297-24433319 TACCGTGGGCTCCCAGAGCTCGG + Intronic
1106419448 13:29573407-29573429 CTCCTTCAGCTGCCAGAGTGTGG - Intronic
1106435539 13:29720448-29720470 CCCCTTCCCCTGCCAGAGCTTGG - Intergenic
1109885334 13:68534790-68534812 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1112047398 13:95612330-95612352 CACCTAGAGCAGCCAGGGCCAGG - Intronic
1113827169 13:113265298-113265320 CACCTTGCCCTCCCATAGCTGGG - Intronic
1116304472 14:43232894-43232916 CACCTTGACCTTCCAGAGCTGGG - Intergenic
1116564903 14:46432530-46432552 CACCTGAAGCTGCCAAGGCTTGG + Intergenic
1117088197 14:52223011-52223033 CACTGTGAGCTCCCAGAGCCTGG + Intergenic
1117666689 14:58063106-58063128 CCCCTGGAGCTGCCAGAGCCAGG - Intronic
1119124285 14:72111161-72111183 CTCCATGAACTGGCAGAGCTAGG - Intronic
1119718546 14:76875592-76875614 CACATTGAGATGCCAGAGGCTGG + Intergenic
1119748668 14:77062394-77062416 CAACGTGAGCTGCTGGAGCTGGG + Intergenic
1120610497 14:86635699-86635721 CACCTTGGCCTCCCAAAGCTCGG - Intergenic
1120680219 14:87472067-87472089 CACCTTGTGCTTCTGGAGCTGGG + Intergenic
1120824969 14:88946640-88946662 CACCTTGGGCTCGCAGATCTAGG - Intergenic
1121777509 14:96600143-96600165 CACCATTAGCTGGCAGAGCGGGG - Intergenic
1125708851 15:41767126-41767148 CACCTATAGCTGCCAAAGTTGGG + Exonic
1127423529 15:58832812-58832834 CACCGTGTGCGGCCAGAACTAGG + Intronic
1127545151 15:59987031-59987053 CACTTTGAGAGGCCAGAGGTTGG + Intergenic
1128303949 15:66585944-66585966 CCCCTTGAGCTGCTACAGGTGGG - Intronic
1128611863 15:69080417-69080439 AATCCTGAGCTGCCAGAGCTTGG - Intergenic
1129169808 15:73800749-73800771 CACTTTGAGCTGCCAGATGTCGG + Intergenic
1129526581 15:76220314-76220336 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1130009276 15:80135873-80135895 CACCTTGGCCTCCCAGTGCTGGG - Intronic
1130538293 15:84802522-84802544 TGCCCTGAGCTGCCAGTGCTGGG + Exonic
1132597030 16:757191-757213 CACCTTGACCTCCCAATGCTAGG - Intronic
1133026538 16:2991174-2991196 CACCAGGAGCTGGGAGAGCTGGG + Intergenic
1134104411 16:11475777-11475799 CACCTTGAGCTGCCAGAGCTTGG + Intronic
1136526022 16:30831229-30831251 CACCAGGAACTGGCAGAGCTAGG + Intergenic
1136642746 16:31580452-31580474 CACGTGGAGCTGCCAAGGCTTGG + Intergenic
1137565803 16:49531818-49531840 TCCCGTGGGCTGCCAGAGCTGGG - Intronic
1138314890 16:56061399-56061421 CACCATGAGCCTCCAGTGCTGGG + Intergenic
1138763930 16:59577710-59577732 CATTTTGAGCTGCGAAAGCTTGG - Intergenic
1139826887 16:69764279-69764301 AACCTTGACCTGCCTGGGCTCGG + Intronic
1141558529 16:84852017-84852039 CACCTTGATCTGCCACCCCTTGG - Intronic
1141961239 16:87410907-87410929 CACCATGAGTTGTCAGAGTTGGG + Intronic
1142142661 16:88479493-88479515 CACCTTGCGCTCCCATAGCGTGG + Intronic
1142357983 16:89612895-89612917 TACCGTGGGCTCCCAGAGCTCGG - Intergenic
1143518821 17:7434087-7434109 CTCCTTCAGCAACCAGAGCTGGG - Intergenic
1143577939 17:7805600-7805622 CACCTTGCCCTCCCAAAGCTTGG - Intronic
1146369031 17:32253157-32253179 CACAGTGCGGTGCCAGAGCTGGG - Intronic
1146623336 17:34417185-34417207 CACCTTAAGCTCAGAGAGCTTGG - Intergenic
1147898729 17:43769642-43769664 GTCATTGAGCTGGCAGAGCTGGG + Exonic
1148097306 17:45061310-45061332 CATCTTGAGTTGCGAGAGCAGGG - Exonic
1150114802 17:62537625-62537647 CACCCTGAGCTGCCTGGGATAGG + Intronic
1150387728 17:64774389-64774411 CACCCTGAGATCCCAGAGCCAGG + Intergenic
1151587992 17:75022757-75022779 TACCGTGGGCTCCCAGAGCTGGG + Intergenic
1152366663 17:79860411-79860433 TACCCTCAGCTGCCAGAGCATGG - Intergenic
1152405236 17:80094462-80094484 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1153299527 18:3580888-3580910 TGCCCTGAGCTGCCAGTGCTGGG + Intronic
1153376681 18:4388423-4388445 CACCTGGAGATACTAGAGCTAGG + Intronic
1153575303 18:6513635-6513657 GACCTGGAGCTGCCAGAGCCTGG - Exonic
1155098713 18:22586843-22586865 CATCATGAGCTGCCAGATCAGGG - Intergenic
1155974876 18:32118283-32118305 CACCTTGGCCTCCCAAAGCTGGG - Intronic
1159096446 18:63907433-63907455 CACTTTGAGAGGCCAGAGGTGGG + Intronic
1161456780 19:4373611-4373633 GTCCTTTTGCTGCCAGAGCTTGG - Intronic
1161767355 19:6214975-6214997 GACCTGGAGCTGCCAGAGCCGGG - Intronic
1161817415 19:6508179-6508201 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1162783902 19:13022400-13022422 CTCCTTCAGCAGCCAGACCTGGG + Intronic
1163174970 19:15557968-15557990 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1163337314 19:16681741-16681763 CACTTTGAGTTGTCACAGCTGGG - Intronic
1164415723 19:28045171-28045193 CAACTGGTGCTGCCAGAGCCTGG - Intergenic
1165002382 19:32775764-32775786 CACCCTGAGCCACCAGAGGTTGG + Intronic
1165528467 19:36376870-36376892 CACTTAAAGCTGCCTGAGCTTGG - Intronic
1166665037 19:44674416-44674438 CACCTTGGCCTCCCAGTGCTGGG + Intronic
926348706 2:11975367-11975389 CACCTGCAGCTGCCAATGCTGGG - Intergenic
926439146 2:12869709-12869731 GACCTTGATTTGCCTGAGCTGGG - Intergenic
927237444 2:20887145-20887167 CACCCTGAGTTGGCAGATCTAGG + Intergenic
927464260 2:23325277-23325299 CACCTTGATCTCCCAGACTTAGG - Intergenic
928323703 2:30303333-30303355 CACCTTGTGTTCCCAGAGCCTGG + Intronic
928413762 2:31074242-31074264 CACTCTGAGCTGCCTGACCTTGG + Intronic
928683677 2:33727473-33727495 CACCTTCAGCAGCCCCAGCTCGG + Intergenic
930003843 2:46880747-46880769 CACCTTGACCAGGCAGAACTGGG + Intergenic
930021335 2:47003843-47003865 CACCCTGGGTGGCCAGAGCTGGG + Intronic
930238594 2:48911834-48911856 CACCTTGGCCTCCCAGTGCTGGG - Intergenic
931192872 2:60022708-60022730 CACCTTGAGGGTCCTGAGCTTGG - Intergenic
933741673 2:85538937-85538959 TATCTTGAGCCGCTAGAGCTAGG - Intergenic
933920594 2:87041427-87041449 CAGCCTGGGCTGTCAGAGCTGGG - Intergenic
933931030 2:87152359-87152381 CAGCCTGGGCTGTCAGAGCTGGG + Intergenic
934002403 2:87728471-87728493 CAGCCTGGGCTGTCAGAGCTGGG + Intergenic
934926914 2:98388563-98388585 CCCCTTGAGTTCCCGGAGCTTGG - Intronic
936362092 2:111813073-111813095 CAGCCTGGGCTGTCAGAGCTGGG - Intronic
936456332 2:112677325-112677347 CAGCTTAAGATTCCAGAGCTAGG + Intergenic
936519466 2:113202483-113202505 CCCTCTGAGCTGCCAGAGATGGG - Exonic
938558662 2:132450117-132450139 TTCCTTGACCTGCCAGAGCCTGG - Intronic
939037080 2:137145538-137145560 GATCTTGAGCTGCCAGAGGTAGG + Intronic
942133638 2:172904769-172904791 CCCCTTGAGGTGCCACATCTAGG + Intronic
942394738 2:175535359-175535381 CAGCCTGAAATGCCAGAGCTTGG + Intergenic
942417478 2:175773937-175773959 GAGCGTGAGCTGCCTGAGCTAGG + Intergenic
942816767 2:180061338-180061360 TACCATGGGCTCCCAGAGCTCGG + Intergenic
944206624 2:197164305-197164327 GACCTTGTGCTGCCAGAGAGGGG - Intronic
946199217 2:218061775-218061797 CACCTTCAGCTGTCAAGGCTGGG + Intronic
947036410 2:225863034-225863056 CACCTTTAGCTGAAAGAGCAAGG - Intergenic
947867374 2:233408593-233408615 CACTGAGAGCTGGCAGAGCTGGG - Intronic
948723227 2:239916711-239916733 CACCTTGTGCTGCCACCTCTGGG + Intronic
948864791 2:240769725-240769747 CACAGTGAGCTGCCGGGGCTAGG + Intronic
948900610 2:240955142-240955164 CATGCTGAGCTGCCAGAACTGGG + Intronic
1169377776 20:5080788-5080810 CACCTTGGCCTCCCAAAGCTGGG + Intronic
1170029785 20:11932735-11932757 CAGCTTGAGGAGTCAGAGCTTGG - Intergenic
1171477475 20:25423360-25423382 CACCTTGGTCTCCCAAAGCTGGG + Intronic
1172356398 20:34283241-34283263 CACCTTGGACAGACAGAGCTAGG + Intronic
1172433826 20:34914357-34914379 CACCTGGGGCGGGCAGAGCTCGG + Exonic
1172452947 20:35041175-35041197 CAGCTTGAGCTGCCATAACAAGG - Intronic
1173547770 20:43912475-43912497 CAGCAGGAGCTGGCAGAGCTGGG + Intergenic
1173812138 20:45962442-45962464 GACCTTGCGATGGCAGAGCTTGG + Intronic
1174497538 20:50959038-50959060 CAGCTAGTGCTGCCCGAGCTGGG + Exonic
1174600506 20:51720583-51720605 CACCTTGACCTCCCAAAGCTGGG - Intronic
1175217977 20:57401402-57401424 AGCCTTGAGCAGCCAGGGCTGGG - Intronic
1175346486 20:58281094-58281116 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1175504002 20:59469368-59469390 CACCTTCAGCTGCTGGTGCTGGG - Intergenic
1175510577 20:59521846-59521868 CACCTTGGCCTCCCAAAGCTGGG - Intergenic
1176139089 20:63537351-63537373 CAGCTGGAGCACCCAGAGCTGGG + Exonic
1176243272 20:64084780-64084802 CACCTTGTCCAGCCAGGGCTGGG + Intronic
1176424576 21:6540252-6540274 CACCTTGCCCAGCCAGACCTTGG - Intergenic
1177849863 21:26333380-26333402 CAGCTTGTGCTGCCAGGCCTGGG - Intergenic
1177963836 21:27702653-27702675 CACCTTGACCTGCCAAAGTGTGG - Intergenic
1179700069 21:43148567-43148589 CACCTTGCCCAGCCAGACCTTGG - Intergenic
1180055392 21:45356383-45356405 CATCCTGAGCTGCCGGGGCTGGG + Intergenic
1180741465 22:18055984-18056006 CATCTCTAGCTCCCAGAGCTGGG + Intergenic
1181532569 22:23525265-23525287 CACCTAGAGCTGCCAGACACTGG + Intergenic
1182117594 22:27766070-27766092 CAGCTTCAGCTCCCAGAGTTGGG - Intronic
1182286282 22:29249951-29249973 CACCTTGCCCAGCCAGATCTTGG - Intronic
1184097763 22:42325729-42325751 AACCATCACCTGCCAGAGCTGGG + Intronic
1184311105 22:43643539-43643561 CAGCCTTGGCTGCCAGAGCTGGG - Intronic
1185418428 22:50721982-50722004 CACCTTGAGCTCGGAGAGCGGGG + Intergenic
950120639 3:10480429-10480451 CTCCATAAGCTGCCAGATCTGGG + Intronic
950252073 3:11474351-11474373 CACCTTGAGAGGCCCGAGGTAGG + Intronic
950613377 3:14140094-14140116 CATCTTGGGCTGTCTGAGCTGGG + Intronic
950725326 3:14913500-14913522 CACCAGTAGCTGTCAGAGCTGGG - Intronic
951559659 3:23953086-23953108 CACCTTGGCCTCCCAGTGCTGGG - Intronic
951702413 3:25509735-25509757 CACCTTGAGCTGACTGAGGAAGG - Intronic
952678250 3:36059647-36059669 CACTTTGAGTACCCAGAGCTTGG + Intergenic
954201784 3:49027663-49027685 CAACCTGGGCTGCTAGAGCTTGG + Intronic
954703088 3:52462357-52462379 CATCTTTAGTTGCCATAGCTGGG - Intronic
956198436 3:66677845-66677867 CACATTGAGAGGCCAAAGCTAGG - Intergenic
956716586 3:72085330-72085352 CACCAGGAGCTGCCACACCTGGG + Intergenic
956717000 3:72087773-72087795 CACCAGGAGCTGCCACACCTGGG + Intergenic
957124370 3:76139504-76139526 TATCTTGAGCTTGCAGAGCTTGG + Intronic
957373258 3:79323815-79323837 CAACTTGAACTGCCACTGCTGGG - Intronic
957587266 3:82148272-82148294 CACTTTAAGCTCCCTGAGCTTGG + Intergenic
960714571 3:120562575-120562597 CACCTCGATCTCCCAAAGCTGGG - Intergenic
961247965 3:125473194-125473216 CACCGGGAACTGCCAGAGCGGGG - Intronic
962232732 3:133679928-133679950 CACCATGTCCTGCCAGTGCTTGG + Intergenic
962942053 3:140134014-140134036 GACCTTGAGAAGTCAGAGCTTGG + Intronic
967269182 3:187718968-187718990 CACCTTTAGCTGCGGGACCTTGG + Intronic
969490393 4:7496301-7496323 CAGCTTGAGCAGCCGGACCTTGG - Intronic
970423518 4:15926429-15926451 CACCTTGGCCTCCCAAAGCTGGG + Intergenic
971317760 4:25581498-25581520 CATCTTCAGATGCCAGTGCTTGG - Intergenic
971392047 4:26195118-26195140 CACCTTGACCTCCCAGTGTTGGG - Intronic
971910385 4:32788693-32788715 CACCTTGGCCTCCCAAAGCTTGG - Intergenic
972292785 4:37705385-37705407 CACCTGGGGCTGCCAGAACCTGG - Intergenic
972682384 4:41318806-41318828 CACATTGAGCAGAGAGAGCTGGG - Intergenic
972695304 4:41439469-41439491 CAACTTCAGCTTCCTGAGCTGGG - Intronic
974086503 4:57266440-57266462 CATCTTGAGCAGACAGAACTTGG - Intergenic
975703541 4:77089576-77089598 CACAGTGGCCTGCCAGAGCTAGG + Intergenic
976296970 4:83482458-83482480 CACCTTGGCCTCCCAGTGCTAGG - Intronic
979638979 4:122989773-122989795 CACATTGTGCTGCCAGAGGTTGG + Intronic
979843499 4:125477302-125477324 TGCCTTGTGCTGCCAAAGCTTGG - Exonic
982243490 4:153324783-153324805 CACCTTGAGAAGCCTGATCTAGG - Intronic
985810099 5:2076292-2076314 GACCTGGAGCTGCCTGAACTGGG - Intergenic
985881245 5:2640677-2640699 CACCTTGAGCTGCCTGGGAGTGG - Intergenic
987978400 5:25046180-25046202 CAGATTGAGCTGACAGAGGTTGG - Intergenic
988060232 5:26158117-26158139 CACTTTCAGCTGACAGAACTAGG + Intergenic
988456801 5:31394020-31394042 TACCGTGGGCTCCCAGAGCTCGG - Intergenic
988699554 5:33659960-33659982 CAGTTTCAGCTGTCAGAGCTTGG + Intronic
989252472 5:39333488-39333510 CACCTCAAGCTGCAACAGCTGGG - Intronic
990026756 5:51201139-51201161 CACTGTGAGGTGCCAGAGCTGGG + Intergenic
991151468 5:63376097-63376119 CAACATGAGATGCTAGAGCTTGG + Intergenic
991986514 5:72292573-72292595 CACCCTGAGCTGCTGGAACTTGG + Intronic
994828138 5:104743152-104743174 ACCCTTGAACTGGCAGAGCTTGG + Intergenic
995573166 5:113502936-113502958 CTCCTTTAGCTACCACAGCTGGG + Intergenic
996785991 5:127237244-127237266 CACCTTGGCCTCCCAGTGCTGGG - Intergenic
1002375526 5:178786313-178786335 CACTGTCAGGTGCCAGAGCTGGG - Intergenic
1002605227 5:180379114-180379136 CACCTGGAGCTGCCAGAAACTGG - Intergenic
1003241871 6:4352201-4352223 CCCCGAGAGCTGCAAGAGCTGGG - Intergenic
1003267037 6:4574981-4575003 CACTTTGACCTGCAAGACCTTGG + Intergenic
1004005338 6:11632805-11632827 CAGCTGCATCTGCCAGAGCTGGG - Intergenic
1005871654 6:29978263-29978285 ATCCTTCAGCTTCCAGAGCTGGG - Intergenic
1007584347 6:42979527-42979549 CACCTAGAGCTCCCAGTACTGGG - Intergenic
1007842475 6:44728060-44728082 CACCTTGCGCTCCCAGATCCTGG - Intergenic
1011194571 6:84767829-84767851 ATCCTTGAGCTCCCAGATCTGGG + Intergenic
1011427166 6:87241706-87241728 CACCGTGTCCGGCCAGAGCTTGG + Intronic
1018156101 6:160986640-160986662 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1018383271 6:163280150-163280172 CAGCATGAGCTGCTAGATCTGGG - Intronic
1018669387 6:166167004-166167026 CACCTGGACCTGGCAGGGCTCGG - Intronic
1018687817 6:166317500-166317522 CACTGTGGGCTCCCAGAGCTCGG + Intergenic
1018691141 6:166345060-166345082 CACTGTGGGCTCCCAGAGCTCGG - Intergenic
1019287332 7:230260-230282 CTCCTGGAGCCCCCAGAGCTGGG + Intronic
1019450736 7:1096428-1096450 GACCCTGAGATCCCAGAGCTGGG + Intronic
1019785185 7:2972278-2972300 CACCATGCCCTGCCAGATCTGGG + Intronic
1020070043 7:5221208-5221230 CACCTCGGGCTCCCAAAGCTTGG + Intronic
1020179055 7:5907107-5907129 CACCTTGGCCTCCCAGTGCTGGG + Intronic
1020507835 7:9016942-9016964 TACCGTGGGCTCCCAGAGCTTGG + Intergenic
1021001788 7:15340628-15340650 CACATGGAGCTGCCAAGGCTTGG - Intronic
1023388860 7:39687999-39688021 CACCTTGGGCTCCCAAAGCTGGG + Intronic
1025783371 7:64621571-64621593 CAGTTTGAGCTGCTGGAGCTGGG - Intergenic
1029117489 7:98244785-98244807 CACCCTGTGGTGCCTGAGCTCGG - Intronic
1029335597 7:99896865-99896887 CAACTGCAGCTGCCACAGCTTGG - Intronic
1029521597 7:101066347-101066369 CAGCTTGCACTGCCTGAGCTGGG - Intergenic
1029835521 7:103305505-103305527 CACCTTGACCTCCCAAAACTTGG + Intronic
1030080177 7:105770839-105770861 CACTTTGAGAAGCAAGAGCTTGG - Intronic
1030694763 7:112572707-112572729 CACCTTGAACTGGATGAGCTTGG + Intergenic
1031529097 7:122854566-122854588 CACCTTGTTCTGGCACAGCTAGG - Intronic
1031766118 7:125779864-125779886 CACCTTGCACTGCTAGAACTGGG + Intergenic
1031768558 7:125812123-125812145 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1032044515 7:128593305-128593327 CACCCTGAGCTGCCTGGGATAGG + Intergenic
1034146039 7:148872950-148872972 CACCTTGTCCTCCCAAAGCTGGG - Intronic
1037582926 8:20256374-20256396 CACCTTGATCTGCCTTAGGTTGG + Intronic
1037656303 8:20887096-20887118 CACCTTGAGAAACCAGAGCCAGG - Intergenic
1039143315 8:34417303-34417325 ATCCTTCAGCTGCGAGAGCTGGG + Intergenic
1039649628 8:39327905-39327927 CAGTTTGAGCTGCTGGAGCTGGG + Intergenic
1039818124 8:41112687-41112709 CACCTTGTACTGCCTCAGCTGGG + Intergenic
1046850167 8:118963086-118963108 CACCTTGACTTGCCAGACCCCGG - Intergenic
1047929693 8:129714227-129714249 CACACTGAGCTGCCAGTGCTGGG + Intergenic
1048294652 8:133205544-133205566 CACCATGAGCTACCTGAGCTGGG - Intronic
1048842215 8:138576278-138576300 CACGTTCTGATGCCAGAGCTCGG - Intergenic
1049473624 8:142787094-142787116 GTCCTTGAGCTGCAAGGGCTCGG + Intergenic
1050028285 9:1358356-1358378 CACACTGAGCTGCCCTAGCTTGG - Intergenic
1050904534 9:10987097-10987119 CACATGGAGCTGCCAAAGCTTGG + Intergenic
1051861021 9:21624850-21624872 CACCTCTAGGTGCCAGACCTGGG - Intergenic
1051899535 9:22024321-22024343 CAGCTGGAGCTGCCACACCTTGG - Intronic
1052528722 9:29655244-29655266 TACCGTGGGCTCCCAGAGCTTGG - Intergenic
1053431827 9:38047017-38047039 AACCTTGAGGTGCCATGGCTAGG - Intronic
1054955694 9:70907268-70907290 CACCTTGTCCTGCCTCAGCTGGG - Intronic
1057283306 9:93727792-93727814 ATCCTTGAGCTCCCAGACCTTGG - Intergenic
1060656595 9:125376452-125376474 GAATTTGAGCTGCCAGAGCAGGG + Intergenic
1061247942 9:129410826-129410848 CACCTAGAGCTGCCAGAAACTGG - Intergenic
1062496409 9:136833557-136833579 CACCCTGGGCTGCCCCAGCTGGG + Intronic
1185712464 X:2314910-2314932 CACCTTGGGATGCCAAAGCGAGG + Intronic
1185822792 X:3220716-3220738 CACCTGGAGCCCCCGGAGCTGGG - Intergenic
1193195886 X:78631386-78631408 CAGCCTGAGCTGGAAGAGCTGGG - Intergenic
1193538676 X:82743753-82743775 CAACTTTTGCTGCCAGAGCTTGG + Intergenic
1196869925 X:120102993-120103015 CACCTTGGCCTCCCAGTGCTGGG + Intergenic
1196935922 X:120730533-120730555 CACCTTGCTCAGCCAGAGCTGGG - Intergenic
1198018944 X:132639686-132639708 CATCTGGAACTGCCAGAGCTAGG + Intronic
1200223400 X:154403266-154403288 TACCTTGCTCTGCCAGTGCTGGG + Exonic
1200886390 Y:8275650-8275672 CACCTTCACCTCCCAGTGCTGGG + Intergenic