ID: 1134110809

View in Genome Browser
Species Human (GRCh38)
Location 16:11514488-11514510
Sequence GCACTCCGGCCCGGAAGCTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134110798_1134110809 15 Left 1134110798 16:11514450-11514472 CCCCGCGGAGTCCAGCTCTGTGC 0: 1
1: 0
2: 0
3: 4
4: 147
Right 1134110809 16:11514488-11514510 GCACTCCGGCCCGGAAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1134110800_1134110809 13 Left 1134110800 16:11514452-11514474 CCGCGGAGTCCAGCTCTGTGCAG 0: 1
1: 0
2: 1
3: 21
4: 208
Right 1134110809 16:11514488-11514510 GCACTCCGGCCCGGAAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1134110803_1134110809 4 Left 1134110803 16:11514461-11514483 CCAGCTCTGTGCAGGAGGCCTCC 0: 1
1: 0
2: 5
3: 34
4: 302
Right 1134110809 16:11514488-11514510 GCACTCCGGCCCGGAAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1134110799_1134110809 14 Left 1134110799 16:11514451-11514473 CCCGCGGAGTCCAGCTCTGTGCA 0: 1
1: 0
2: 1
3: 6
4: 145
Right 1134110809 16:11514488-11514510 GCACTCCGGCCCGGAAGCTCTGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134110809 Original CRISPR GCACTCCGGCCCGGAAGCTC TGG Exonic
900291815 1:1926883-1926905 GCACCCCGCACCTGAAGCTCAGG + Exonic
900314606 1:2050584-2050606 GCGCTGCGCCCCGGGAGCTCCGG - Exonic
902323588 1:15684356-15684378 CCACCGCGGCCCGGAGGCTCCGG - Exonic
902350186 1:15848249-15848271 GGACTCCGGCCCGGACCCACGGG + Intronic
902573661 1:17363151-17363173 GCACTCCAGCCTGGCAGCTTGGG - Intronic
912431749 1:109631680-109631702 CCACTCAGGCCAGGAAGCCCAGG - Exonic
916219822 1:162433130-162433152 CCACACCTGCCCGGAAGCTGAGG - Intergenic
1063309317 10:4937646-4937668 GCCCCCCGGCCCGCAAGCCCCGG - Intronic
1065293981 10:24257663-24257685 ACACTGAGGCCAGGAAGCTCAGG + Intronic
1074911620 10:117914906-117914928 GCACTCCAGCCTGGAAGCCTGGG + Intergenic
1076723407 10:132402469-132402491 GCATGCTGGCCCAGAAGCTCAGG + Intronic
1081632352 11:44698354-44698376 GCACTCAGGCCCAGCTGCTCTGG + Intergenic
1083028504 11:59570837-59570859 GCACTCCAGCCTGGAAGCCTGGG + Intergenic
1084278138 11:68066924-68066946 GCACTCCAGCTGGGAAGCTGTGG + Intronic
1089556200 11:119317097-119317119 GCCCTCCGGCCGGGAAGCATGGG - Exonic
1091451050 12:572067-572089 GCAATCCGGGCCGGGAGCACTGG + Intronic
1091749875 12:3015545-3015567 GCACCGCGGCCTGGAGGCTCAGG - Intronic
1093967966 12:25346828-25346850 GCACTCCAGCCTGGAAGCCTGGG - Intergenic
1095171781 12:39044594-39044616 TCACTCTGGCCCGGGACCTCTGG - Intergenic
1101892845 12:108731606-108731628 GCACAGCGGCCCGGCAGCCCTGG - Intergenic
1104692648 12:130838812-130838834 GGACTCCGCCCAGGAAGCCCTGG + Intronic
1104884042 12:132094489-132094511 ACACTCAGGCCCAGAAGCGCCGG - Intronic
1104900410 12:132187077-132187099 GCAGCCTGGCCCGGTAGCTCGGG - Intergenic
1105022865 12:132828827-132828849 GCCGCCCGGCCCGGATGCTCCGG + Intronic
1107299011 13:38946233-38946255 GCACTCCAGCCTGGCAGCTCGGG - Intergenic
1109265014 13:60188055-60188077 GCATTTCTGTCCGGAAGCTCTGG + Intergenic
1114653287 14:24300119-24300141 GCACCTGAGCCCGGAAGCTCTGG + Exonic
1121522895 14:94598653-94598675 GCACTGTGACCCGGACGCTCAGG + Intronic
1124818828 15:33022666-33022688 GCACTTCAGGCCTGAAGCTCTGG + Intronic
1126649788 15:50908935-50908957 GCCCGCCGGCCCGGGAGCTCAGG + Intronic
1134110809 16:11514488-11514510 GCACTCCGGCCCGGAAGCTCTGG + Exonic
1141128664 16:81419441-81419463 GCACTCCAGCCTGGCAGCCCGGG + Intergenic
1147158896 17:38559463-38559485 GGACTCGGGCGTGGAAGCTCTGG + Intronic
1147793190 17:43025665-43025687 GCCCTCCCTCCCGGATGCTCTGG - Intronic
1148838449 17:50478981-50479003 GCGCGCCGGCCCGCAGGCTCAGG - Exonic
1149529927 17:57386958-57386980 GCACTTCTGCCTGGAAGCCCAGG - Intronic
1149610638 17:57955668-57955690 GCCCTCCTGCCCGCAAGCTAGGG - Intergenic
1152427040 17:80223602-80223624 GCACACTGGCACGGAAACTCGGG - Intronic
1152667124 17:81577624-81577646 GGACTCAGGTCTGGAAGCTCAGG - Intronic
1161058037 19:2200406-2200428 GCACCCAGGCCTGGGAGCTCAGG + Intronic
1161364768 19:3872031-3872053 GCTGGCCGGCCCGGAAGCTGGGG + Intergenic
1161469195 19:4447926-4447948 GCACTGCGGCCCTTCAGCTCTGG - Intronic
1165450906 19:35881959-35881981 GCACTCCAGTCCAGAAGCCCTGG - Intergenic
925090129 2:1148606-1148628 GCATCCCGCCCCGGGAGCTCAGG - Intronic
925715736 2:6782806-6782828 GCCCTCCGGGCCGGATGCCCAGG + Intergenic
928203977 2:29271098-29271120 GCACTCAGGCCCGGCAGGTCCGG - Intronic
934844920 2:97656519-97656541 GCATTCTGGCCCTGGAGCTCAGG + Exonic
938110842 2:128563842-128563864 GCACTCCAGCCCTCCAGCTCAGG - Intergenic
940112660 2:150171290-150171312 GCCGGCCGGCCCGGAAGCCCCGG - Intergenic
941018193 2:160380769-160380791 CCACTGCGGCCAGGAAGCTGGGG + Intronic
947620259 2:231585521-231585543 GCACTCCAGCCCGCAACCTGGGG + Intergenic
948560305 2:238847573-238847595 GCACCGCGGCCCGCAAGCTTAGG - Intergenic
949019775 2:241734628-241734650 CCACTCCGGCTCGGCGGCTCTGG + Exonic
1168869168 20:1114227-1114249 GCACTCCTACCCGGGAACTCTGG - Intronic
1173688762 20:44942688-44942710 CCACCCCGGCCCAGGAGCTCAGG + Exonic
1174006253 20:47413213-47413235 GCTCTACGGCCAGGAAGCTGTGG + Intergenic
1176125203 20:63472021-63472043 GCACTCCCGCCGGGGAGCGCCGG + Intronic
1180632517 22:17239512-17239534 GCATTCCTGACCGGAGGCTCTGG - Intergenic
1181087701 22:20449943-20449965 CCGCCCCGGCCCGGAGGCTCTGG - Intronic
1183469303 22:37997167-37997189 AGACTCCGGCTGGGAAGCTCAGG - Intronic
1184910301 22:47527653-47527675 GCAGCCCGGCCCGGTGGCTCAGG - Intergenic
950495280 3:13330152-13330174 GCACTCCAGTCAGGAAGCTGTGG + Intronic
955237476 3:57152235-57152257 GCATTCCAGCCCAGGAGCTCCGG + Intronic
957504279 3:81099590-81099612 TCACTTGGGCCCGGAAGTTCAGG + Intergenic
961518083 3:127450907-127450929 GCACACCGGCCCAGAGGCCCAGG + Intergenic
966684835 3:182682738-182682760 GCGCGCCGGCCCGGGAGCCCGGG + Intergenic
968868781 4:3230447-3230469 GCTGTCCAGCCAGGAAGCTCGGG - Intronic
970797224 4:19927562-19927584 TCACTGCAGCCCGGAAGCTCTGG + Intergenic
981305150 4:143239551-143239573 GAAGTCCGTCCCAGAAGCTCAGG + Intergenic
996836934 5:127803985-127804007 CCACTGAGGCCTGGAAGCTCAGG + Intergenic
997453943 5:134004356-134004378 GCACTTCCGCCCGCAAGCCCGGG + Intronic
1009762521 6:68025929-68025951 GCACTTCAGCCCGGAAGTACTGG - Intergenic
1018902065 6:168056643-168056665 GAACTCCGGCTTGGGAGCTCTGG + Exonic
1019719304 7:2558918-2558940 GCGCTCCGCCCCGGGAACTCCGG + Intergenic
1032563230 7:132913992-132914014 GCACTCCAGCCTGGAAGCCTGGG - Intronic
1034449408 7:151129345-151129367 CCGCCCCGGCCCAGAAGCTCTGG + Intronic
1035833902 8:2727933-2727955 GCAGGCCGGCCCGCAAGCCCCGG + Intergenic
1037279322 8:17219213-17219235 GCACTCCAGCCTGGGAGCTTGGG + Intronic
1040065037 8:43138791-43138813 GCACTCCAGCCTGGCAGGTCAGG - Intergenic
1044173354 8:89084928-89084950 GCACTCCAGCCTGGAAGCCTGGG - Intergenic
1044591325 8:93916889-93916911 GCACTCCGGCCCGAACGTGCGGG + Intronic
1049591409 8:143464615-143464637 GGACACCGGGCCCGAAGCTCTGG - Intronic
1052903956 9:33817648-33817670 GCCCTCCGGCCGGGCAGCACCGG - Exonic
1052924746 9:34005398-34005420 GCACTCCAGCCTGGAAGCCAGGG + Intronic
1057300692 9:93880039-93880061 GCCCTCCGGCCCACAAGCCCAGG + Intergenic
1058856851 9:109070914-109070936 GCACTCCGGCCTGGATGATAGGG - Intronic
1059438471 9:114289908-114289930 GCACTCTGGCCTGGAAGCCTGGG - Intronic
1062552761 9:137097642-137097664 GCTCTCAGGCACGGGAGCTCAGG + Intronic
1062579194 9:137222065-137222087 GCGCCTCGGCCCGGCAGCTCGGG + Intergenic
1192111718 X:68371777-68371799 GCACTCCAGCCCGGCAGCCCGGG - Intronic
1194890496 X:99372299-99372321 GCAGGCCGGCCCGCAAGCCCCGG - Intergenic
1197697842 X:129569876-129569898 GCACTCCAGCCCGGAGGATAGGG - Intronic