ID: 1134113961

View in Genome Browser
Species Human (GRCh38)
Location 16:11534257-11534279
Sequence AACCTTGTCCTGCTCCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134113957_1134113961 23 Left 1134113957 16:11534211-11534233 CCCAGGCAACAGAGGGAGACTCC 0: 40
1: 1623
2: 22757
3: 83962
4: 145365
Right 1134113961 16:11534257-11534279 AACCTTGTCCTGCTCCTGGAAGG No data
1134113959_1134113961 2 Left 1134113959 16:11534232-11534254 CCGTCTCAAAAAAAAAAAAAAAG 0: 7194
1: 95351
2: 66312
3: 83357
4: 126880
Right 1134113961 16:11534257-11534279 AACCTTGTCCTGCTCCTGGAAGG No data
1134113958_1134113961 22 Left 1134113958 16:11534212-11534234 CCAGGCAACAGAGGGAGACTCCG 0: 34
1: 1009
2: 5228
3: 11221
4: 16100
Right 1134113961 16:11534257-11534279 AACCTTGTCCTGCTCCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134113961 Original CRISPR AACCTTGTCCTGCTCCTGGA AGG Intergenic
No off target data available for this crispr