ID: 1134117560

View in Genome Browser
Species Human (GRCh38)
Location 16:11560685-11560707
Sequence AAGGTTATAGAGAAGGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134117552_1134117560 16 Left 1134117552 16:11560646-11560668 CCTAATATACAGCAAAGCTGTGA 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1134117560 16:11560685-11560707 AAGGTTATAGAGAAGGGGAAAGG No data
1134117556_1134117560 -8 Left 1134117556 16:11560670-11560692 CCGTGGGAGTCACAGAAGGTTAT No data
Right 1134117560 16:11560685-11560707 AAGGTTATAGAGAAGGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134117560 Original CRISPR AAGGTTATAGAGAAGGGGAA AGG Intronic
No off target data available for this crispr