ID: 1134119966

View in Genome Browser
Species Human (GRCh38)
Location 16:11576819-11576841
Sequence TGATAAATATATACCTTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134119959_1134119966 28 Left 1134119959 16:11576768-11576790 CCGTGGGCGCCTCCTCTGAGTGA No data
Right 1134119966 16:11576819-11576841 TGATAAATATATACCTTATTTGG No data
1134119963_1134119966 16 Left 1134119963 16:11576780-11576802 CCTCTGAGTGAGGTAAACAGGCT No data
Right 1134119966 16:11576819-11576841 TGATAAATATATACCTTATTTGG No data
1134119961_1134119966 19 Left 1134119961 16:11576777-11576799 CCTCCTCTGAGTGAGGTAAACAG No data
Right 1134119966 16:11576819-11576841 TGATAAATATATACCTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134119966 Original CRISPR TGATAAATATATACCTTATT TGG Intronic
No off target data available for this crispr