ID: 1134121223

View in Genome Browser
Species Human (GRCh38)
Location 16:11586496-11586518
Sequence GCGATTCTCTCTAGTGACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134121223_1134121236 22 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121236 16:11586541-11586563 GGCCGTCCTCTCCGGGGAGGGGG No data
1134121223_1134121227 1 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121227 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
1134121223_1134121233 19 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121233 16:11586538-11586560 AGGGGCCGTCCTCTCCGGGGAGG No data
1134121223_1134121234 20 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121234 16:11586539-11586561 GGGGCCGTCCTCTCCGGGGAGGG No data
1134121223_1134121231 16 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121231 16:11586535-11586557 CCCAGGGGCCGTCCTCTCCGGGG No data
1134121223_1134121235 21 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121235 16:11586540-11586562 GGGCCGTCCTCTCCGGGGAGGGG No data
1134121223_1134121224 -1 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121224 16:11586518-11586540 CGCCTTTTTCTAAAAAGCCCAGG No data
1134121223_1134121239 28 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121239 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG No data
1134121223_1134121225 0 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121225 16:11586519-11586541 GCCTTTTTCTAAAAAGCCCAGGG No data
1134121223_1134121229 15 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121229 16:11586534-11586556 GCCCAGGGGCCGTCCTCTCCGGG No data
1134121223_1134121228 14 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121228 16:11586533-11586555 AGCCCAGGGGCCGTCCTCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134121223 Original CRISPR GCGATTCTCTCTAGTGACTC AGG (reversed) Intronic
No off target data available for this crispr