ID: 1134121226

View in Genome Browser
Species Human (GRCh38)
Location 16:11586520-11586542
Sequence CCCCTGGGCTTTTTAGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134121226_1134121240 7 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121240 16:11586550-11586572 CTCCGGGGAGGGGGACGCGGCGG No data
1134121226_1134121243 17 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121243 16:11586560-11586582 GGGGACGCGGCGGGCCGCGAAGG No data
1134121226_1134121228 -10 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121228 16:11586533-11586555 AGCCCAGGGGCCGTCCTCTCCGG No data
1134121226_1134121229 -9 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121229 16:11586534-11586556 GCCCAGGGGCCGTCCTCTCCGGG No data
1134121226_1134121245 29 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121245 16:11586572-11586594 GGCCGCGAAGGGCGCTCGTTCGG No data
1134121226_1134121235 -3 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121235 16:11586540-11586562 GGGCCGTCCTCTCCGGGGAGGGG No data
1134121226_1134121239 4 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121239 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG No data
1134121226_1134121234 -4 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121234 16:11586539-11586561 GGGGCCGTCCTCTCCGGGGAGGG No data
1134121226_1134121231 -8 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121231 16:11586535-11586557 CCCAGGGGCCGTCCTCTCCGGGG No data
1134121226_1134121246 30 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data
1134121226_1134121244 18 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121244 16:11586561-11586583 GGGACGCGGCGGGCCGCGAAGGG No data
1134121226_1134121241 8 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121241 16:11586551-11586573 TCCGGGGAGGGGGACGCGGCGGG No data
1134121226_1134121236 -2 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121236 16:11586541-11586563 GGCCGTCCTCTCCGGGGAGGGGG No data
1134121226_1134121233 -5 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121233 16:11586538-11586560 AGGGGCCGTCCTCTCCGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134121226 Original CRISPR CCCCTGGGCTTTTTAGAAAA AGG (reversed) Intronic
No off target data available for this crispr