ID: 1134121232

View in Genome Browser
Species Human (GRCh38)
Location 16:11586536-11586558
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134121232_1134121241 -8 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121241 16:11586551-11586573 TCCGGGGAGGGGGACGCGGCGGG No data
1134121232_1134121252 24 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121252 16:11586583-11586605 GCGCTCGTTCGGGTGGGGGCCGG No data
1134121232_1134121243 1 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121243 16:11586560-11586582 GGGGACGCGGCGGGCCGCGAAGG No data
1134121232_1134121249 18 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121249 16:11586577-11586599 CGAAGGGCGCTCGTTCGGGTGGG No data
1134121232_1134121251 20 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121251 16:11586579-11586601 AAGGGCGCTCGTTCGGGTGGGGG No data
1134121232_1134121248 17 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121248 16:11586576-11586598 GCGAAGGGCGCTCGTTCGGGTGG No data
1134121232_1134121244 2 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121244 16:11586561-11586583 GGGACGCGGCGGGCCGCGAAGGG No data
1134121232_1134121250 19 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121250 16:11586578-11586600 GAAGGGCGCTCGTTCGGGTGGGG No data
1134121232_1134121245 13 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121245 16:11586572-11586594 GGCCGCGAAGGGCGCTCGTTCGG No data
1134121232_1134121240 -9 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121240 16:11586550-11586572 CTCCGGGGAGGGGGACGCGGCGG No data
1134121232_1134121246 14 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134121232 Original CRISPR TCCCCGGAGAGGACGGCCCC TGG (reversed) Intronic
No off target data available for this crispr