ID: 1134121238

View in Genome Browser
Species Human (GRCh38)
Location 16:11586547-11586569
Sequence CCGCGTCCCCCTCCCCGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 200}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134121238_1134121245 2 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121245 16:11586572-11586594 GGCCGCGAAGGGCGCTCGTTCGG No data
1134121238_1134121252 13 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121252 16:11586583-11586605 GCGCTCGTTCGGGTGGGGGCCGG No data
1134121238_1134121246 3 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data
1134121238_1134121251 9 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121251 16:11586579-11586601 AAGGGCGCTCGTTCGGGTGGGGG No data
1134121238_1134121250 8 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121250 16:11586578-11586600 GAAGGGCGCTCGTTCGGGTGGGG No data
1134121238_1134121248 6 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121248 16:11586576-11586598 GCGAAGGGCGCTCGTTCGGGTGG No data
1134121238_1134121249 7 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121249 16:11586577-11586599 CGAAGGGCGCTCGTTCGGGTGGG No data
1134121238_1134121244 -9 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121244 16:11586561-11586583 GGGACGCGGCGGGCCGCGAAGGG No data
1134121238_1134121243 -10 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121243 16:11586560-11586582 GGGGACGCGGCGGGCCGCGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134121238 Original CRISPR CCGCGTCCCCCTCCCCGGAG AGG (reversed) Intronic
901064898 1:6489977-6489999 CCGCATCCCCCACCCCTAAGTGG + Intronic
904043950 1:27599393-27599415 GCGCCTCCCCCTCCCCTGGGGGG + Intronic
904044129 1:27600177-27600199 CCCCGCCCCCCTCCCTGGGGGGG + Intronic
904078377 1:27856752-27856774 CCATGTTCCCCTCCCCGGGGGGG + Intergenic
904190296 1:28737706-28737728 CCGCGTCCCCCTCCCGGCTCAGG - Intronic
906169011 1:43707889-43707911 CGGCGGCCCCCACCCAGGAGAGG - Intronic
915485411 1:156216780-156216802 CCGCCGCCCCTTCCCCGGAGTGG + Intronic
916588301 1:166166609-166166631 CCGCCTCCTCCTCTCCGGCGAGG - Exonic
921132546 1:212232210-212232232 CCGGGCCTCCCTCCCCAGAGGGG + Intergenic
921355443 1:214281061-214281083 GCCCGTCCCCCTCCCCGCGGGGG + Intergenic
1064086625 10:12350102-12350124 CCCCCTCCCCCTCCCGGGAACGG - Intronic
1064764761 10:18659564-18659586 CCGGGTCCCCCACCGCGGCGCGG - Exonic
1065092837 10:22252481-22252503 GCGCGGCCCCCTCCCCGGCCTGG + Intergenic
1067695674 10:48534067-48534089 CTGCCTCCCCCTCCAAGGAGTGG - Intronic
1069034193 10:63630435-63630457 CCGCCTCCCTCTCCCCGGCGCGG - Intergenic
1072491012 10:95906080-95906102 CCGCGCCCCCCGCCCCCCAGAGG - Intronic
1072804320 10:98415076-98415098 CCGCCTCTCCCTTCCCGGCGTGG - Exonic
1074618521 10:115093604-115093626 CCGAGTCCCGCTCCCCGGTCAGG - Exonic
1075259258 10:120949021-120949043 CCGCGGCTCCCTCCCTGTAGAGG - Intergenic
1076618175 10:131770713-131770735 ACCCTTCCACCTCCCCGGAGGGG + Intergenic
1076631581 10:131855196-131855218 CCTCGGCCACCTCCCTGGAGTGG - Intergenic
1076762226 10:132611487-132611509 CTCCGTCACCCTCCCCGGACAGG - Intronic
1076821547 10:132942363-132942385 CCACGACCCCCGCCCCGGGGAGG - Intronic
1076821566 10:132942398-132942420 CCACGACCCCCGCCCCGGGGAGG - Intronic
1077011776 11:381937-381959 CGTCGTGCCCCTCCCCGGAGAGG + Exonic
1077168784 11:1157206-1157228 CAGCCTCACCCTCCCTGGAGAGG - Intergenic
1083651953 11:64209119-64209141 CCGTGTCCCCCAGCCCTGAGAGG + Intronic
1084359321 11:68659561-68659583 CCCCGTCCATCTGCCCGGAGAGG - Intergenic
1085391262 11:76183505-76183527 CAGCATCCACCTCCCCGGAGTGG + Intergenic
1085561261 11:77474197-77474219 CCCACTCCCCCTCCCCGGCGCGG + Intronic
1094841487 12:34344342-34344364 CCGGGTTCCCACCCCCGGAGTGG - Intergenic
1096413158 12:51391560-51391582 CCGCGACCCTCTCCCCGGGAGGG - Intronic
1096668229 12:53181029-53181051 CCGCGTCCCCGGCCCGGGAGAGG + Intronic
1096779782 12:53985174-53985196 CCGCGCCCCCCCTCCCGGATGGG + Exonic
1096788503 12:54031228-54031250 CCGCCTCCAACTCCCGGGAGTGG - Intronic
1096848241 12:54419370-54419392 CCGCGTCCCCCACCCCTAAGGGG + Exonic
1100444826 12:94650593-94650615 CCGCCTCCCCCACCCCGCGGCGG - Intergenic
1105071426 12:133236182-133236204 CCGCGACCCCCGCCCTGCAGCGG + Intergenic
1112580753 13:100674766-100674788 CCGCATCTCCCTCCCGGGTGCGG + Exonic
1113876579 13:113598412-113598434 CAGCATCCCTCTCCCAGGAGAGG - Intronic
1114270628 14:21098228-21098250 CCCCCTCCCCCCTCCCGGAGGGG - Intronic
1115399284 14:32939251-32939273 CCACGCCCCCCACCCGGGAGGGG + Intronic
1117424492 14:55580450-55580472 CCGCGCCCCCCCGCCCGGCGCGG - Intronic
1118729544 14:68656710-68656732 CCAGGTCCCCCACCCCTGAGAGG + Intronic
1119743414 14:77028156-77028178 TCTTGGCCCCCTCCCCGGAGTGG + Exonic
1122738740 14:103858647-103858669 CCCCGGCCCCCTCCCCTGACGGG + Intergenic
1122741060 14:103871907-103871929 CCGCGTCCTCCTCCACCGGGAGG - Intergenic
1124340442 15:28886489-28886511 CCGCTTCCCCCTCCCACGACGGG + Intronic
1124352960 15:28971676-28971698 CCACCTCCTCCTCCCCTGAGAGG - Intronic
1124629242 15:31327556-31327578 CCGCGCCCCCCAGCCCGGCGTGG + Exonic
1129356488 15:74995563-74995585 CCCCGCCCCCAGCCCCGGAGCGG + Intronic
1129376817 15:75138731-75138753 CTGTGTCCCCCTTCCAGGAGGGG - Intergenic
1129687734 15:77696167-77696189 CCACCGCCCCCTCCCTGGAGAGG - Intronic
1131060271 15:89400107-89400129 CCACGTCCCCCTCCCGGGCGGGG + Intergenic
1132889321 16:2196281-2196303 CCGGGGGCCCCTCCCCGGCGCGG - Intronic
1132947162 16:2538033-2538055 CAGCGTCCTCCTCCCCGAAGCGG - Exonic
1132999212 16:2840802-2840824 CCCCTTCCCCCTCTCCTGAGTGG + Intergenic
1133978452 16:10617013-10617035 TCGGCTCCCCCTCCCCAGAGGGG - Intergenic
1134121238 16:11586547-11586569 CCGCGTCCCCCTCCCCGGAGAGG - Intronic
1136226397 16:28863427-28863449 CCGCGTGCCCCTCCACAGCGGGG + Intronic
1137617089 16:49854963-49854985 CCGGGGCGCCCTCCGCGGAGGGG + Intronic
1137787997 16:51152651-51152673 GCGCGGCCCCCTCCCCAGGGCGG - Intergenic
1139551435 16:67675226-67675248 CAGCCTCCCACTCCCCGGATCGG + Exonic
1140258014 16:73353293-73353315 CCGAGTCCCCCTGGCCAGAGTGG + Intergenic
1142491390 17:281892-281914 CCGCTTCCTCCTCCGCCGAGGGG + Intronic
1142637659 17:1268194-1268216 CCGGGACCCGCTCTCCGGAGGGG + Intergenic
1143030465 17:3964472-3964494 CCGGGACTCCCTCCCCGGGGCGG + Intergenic
1143104248 17:4520436-4520458 CCTCGTCACCCCCCCGGGAGGGG + Intronic
1143860064 17:9882864-9882886 CCCAGTCCCCATCCCTGGAGTGG - Intronic
1144775303 17:17782154-17782176 CCGCGGCCCCCGCCCCTGCGCGG - Intronic
1145903941 17:28506272-28506294 CAGCTTCCCCTTGCCCGGAGGGG - Intronic
1147948287 17:44092759-44092781 CAGAGTTCCCCTCCCCAGAGCGG - Exonic
1147967241 17:44199797-44199819 CCGCACCCCCCGCCCGGGAGAGG - Intronic
1147987814 17:44316368-44316390 CCTCCTCCCCCTCCCAGGACAGG + Exonic
1148095600 17:45050979-45051001 CCGCTTCCCTCTCCCCTGGGAGG - Intronic
1150207574 17:63420576-63420598 CCCCCTTCCCCTCTCCGGAGAGG + Exonic
1150270317 17:63860019-63860041 CTGTGTCCCCCTCCCAGGAAAGG - Intergenic
1151719587 17:75847651-75847673 CTGCGGCCCCCTCCCGGGTGAGG + Intronic
1152039339 17:77892892-77892914 CGGCGACGCCCTCCCCTGAGGGG + Intergenic
1152574040 17:81132461-81132483 CTGCGTCCCCCATCCCTGAGTGG - Intronic
1152729011 17:81960912-81960934 CCGCGTCCACCTGCGGGGAGCGG + Exonic
1152928141 17:83097270-83097292 CCCAGTCCCCCACCCCGGAGTGG - Intergenic
1154151337 18:11908695-11908717 CCGCGTCCCCCGCCCTTCAGCGG - Exonic
1156036174 18:32770371-32770393 CCGCCGACCCCTCCCCCGAGAGG + Exonic
1159424906 18:68272519-68272541 CCCCTTCCCCCTCCCAAGAGTGG + Intergenic
1160248843 18:77183699-77183721 CCCCCTCACCCTCCCCGGACAGG + Intergenic
1160568547 18:79801346-79801368 CTGCGTCCTCCTCCCCCGAGGGG + Intergenic
1160653427 19:246604-246626 ACGCCTCCGCGTCCCCGGAGGGG + Intergenic
1160763617 19:797692-797714 CCGCGTCCCCATCCCCCGTCCGG + Intronic
1161162123 19:2767444-2767466 CCACGTCCCCAGCCCAGGAGAGG + Intronic
1161493335 19:4574801-4574823 TGGGGGCCCCCTCCCCGGAGGGG - Intergenic
1162344941 19:10113501-10113523 CCCGGTCCCCCTCCAGGGAGGGG + Intronic
1162798231 19:13097630-13097652 CCGCGCCCCCGTACCCGGACGGG - Intronic
1162893097 19:13748036-13748058 CCGCGTCCCCCGACGCGGAAGGG - Intronic
1164155761 19:22596076-22596098 CCCCGCCCCTCTCCCCAGAGTGG + Intergenic
1165022235 19:32934494-32934516 CCGCCTCTCCCTCCCCTGGGAGG - Intronic
1166354133 19:42217170-42217192 CGGCCTCCCCCTCCCCCGGGAGG + Intronic
1168340708 19:55621684-55621706 CCCCGTCCCCCTCCCCGGGTCGG + Exonic
926423345 2:12718877-12718899 CCGGGTCCCGCTGCCCGGGGGGG + Intronic
932460639 2:71879725-71879747 CCGCGTCCCCCTCCCCAGCATGG - Intergenic
935263013 2:101371128-101371150 CCCCTGCCCCCTCCCCGTAGAGG + Intronic
939178676 2:138780453-138780475 CCGCGCGCCCCTCCTCGGAGGGG + Intergenic
948751696 2:240136795-240136817 CCGCGTCTCACTCCCCGCCGCGG - Intronic
1169118655 20:3082913-3082935 CCGCGTCCCCCCCACCCAAGCGG + Intronic
1169214738 20:3786524-3786546 CCGGGCCCCCCGCCCCGGGGCGG - Exonic
1170540114 20:17379185-17379207 CCATGTCCCCCACCCAGGAGGGG + Intronic
1172061538 20:32190194-32190216 GCGCGTCCCCCTCCCGGGCAAGG + Intergenic
1172178508 20:32986801-32986823 CCGCGTCCCCCGCCCCAGCCTGG + Intronic
1172474442 20:35226637-35226659 CCGCGCGCCCCGCCCCGGTGGGG - Exonic
1173644140 20:44623024-44623046 CCGAGCCCACCTCCCCGGCGTGG + Exonic
1174649265 20:52110753-52110775 CAAAGTCCCCCTCCCGGGAGAGG + Intronic
1174705625 20:52653040-52653062 CCCCTTTCCCCTCCCTGGAGGGG + Intergenic
1175714640 20:61247322-61247344 CCCCGCCCGCCTCCCCGGCGTGG - Intergenic
1175803923 20:61816847-61816869 CCCCATCCCCCTGCCCGGTGGGG + Intronic
1175913054 20:62413758-62413780 CCACGTCCCCCACCCCGGGCCGG - Intronic
1176189411 20:63800810-63800832 GAGCCTCCCCCTCCCCGCAGTGG + Intronic
1176221151 20:63969848-63969870 CCGCGCCCCCCGCCCCGGCCCGG - Intronic
1176429087 21:6565045-6565067 CCGAGTCTCCCTCCCCGTGGCGG - Intergenic
1176546959 21:8206328-8206350 CCGCCGCCCCTTCCCCGGAGTGG + Intergenic
1176549274 21:8214455-8214477 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1176554864 21:8250537-8250559 CCGCCGCCCCTTCCCCGGAGTGG + Intergenic
1176557167 21:8258678-8258700 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1176565910 21:8389375-8389397 CCGCCGCCCCTTCCCCGGAGTGG + Intergenic
1176568206 21:8397493-8397515 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1176573785 21:8433562-8433584 CCGCCGCCCCTTCCCCGGAGTGG + Intergenic
1176576109 21:8441713-8441735 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1178437048 21:32569371-32569393 CCGCATTCCGCTCCCCGGAACGG + Intergenic
1179025464 21:37675579-37675601 CCGCATCGCCCTGCCCTGAGCGG + Intronic
1179209336 21:39312933-39312955 CCGCCCCCCCCGCGCCGGAGGGG - Intronic
1179704577 21:43173361-43173383 CCGAGTCTCCCTCCCCGTGGCGG - Intergenic
1180014430 21:45073429-45073451 CCGCTTCCCCCACCCAGGTGCGG + Intergenic
1180832960 22:18915310-18915332 CAGCTTCCCCCTCCCCTGAGTGG - Intronic
1181147396 22:20858691-20858713 CCGCCTCCGCCTCCCCGGGCCGG + Exonic
1181182810 22:21079303-21079325 CCCAGTCCCCCTGCCCTGAGAGG - Intergenic
1182315233 22:29441705-29441727 CCACGTCCACCTCCCAGTAGTGG - Exonic
1182694849 22:32191167-32191189 CCACGTCCACCTCCCAGCAGTGG + Exonic
1182716535 22:32360415-32360437 CCACGTCCACCTCCCAGTAGTGG - Exonic
1183601646 22:38843688-38843710 CCGCGTCCCCGGGCCCGCAGCGG - Exonic
1184098818 22:42330919-42330941 CCAAGTCCCCCACCCCTGAGTGG + Intronic
1184156403 22:42670274-42670296 CCGTGTCCCCCACCCAGGGGTGG - Intergenic
1184766687 22:46576150-46576172 CTGCCTCCCCCTCCCCAGACTGG - Intronic
1185192058 22:49444935-49444957 CCGTGTCGCACTCCCCAGAGAGG + Intronic
1203251834 22_KI270733v1_random:122613-122635 CCGCCGCCCCTTCCCCGGAGTGG + Intergenic
1203254159 22_KI270733v1_random:130771-130793 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1203259885 22_KI270733v1_random:167696-167718 CCGCCGCCCCTTCCCCGGAGTGG + Intergenic
1203262215 22_KI270733v1_random:175850-175872 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1203283044 22_KI270734v1_random:140614-140636 CAGCTTCCCCCTCCCCTGAGTGG - Intergenic
953485103 3:43287018-43287040 CCCCGCGCCCCGCCCCGGAGCGG + Intronic
954414380 3:50385805-50385827 GCGCCTCCCCCTCCTCTGAGCGG - Intronic
955298733 3:57757011-57757033 CCGCGTCCCCCTTCCCGGGGCGG + Exonic
955352054 3:58200904-58200926 CCTCCTCCCCCTCCCTGGAGAGG + Intronic
958661737 3:97077541-97077563 CCCCATCCCCCTCCCCTGACAGG + Intronic
961008905 3:123423313-123423335 CCGCTTCCCCTTCTCCGCAGGGG - Intronic
961305677 3:125958220-125958242 CGGCGGCCCCCTCGCCGGCGGGG - Intergenic
961461844 3:127055526-127055548 TCGGGTCCCCCTCCCCACAGTGG - Intergenic
961934656 3:130570567-130570589 CCTCGTCCCACTCCCTGCAGTGG + Intronic
963638514 3:147829917-147829939 CCTTGTCCCCCACCCCGGACAGG - Intergenic
966182067 3:177197143-177197165 CCGCTCCCCCCTCCCGGGAATGG + Intronic
967118444 3:186362086-186362108 CTGCATCCCCCTCCCCCGAGAGG - Exonic
968090371 3:195895345-195895367 CCGCAGCCCCCGCCCCGCAGCGG + Exonic
969472032 4:7394618-7394640 CCTCCTCCCCCTCCCTCGAGGGG - Intronic
973137346 4:46724538-46724560 CCGCCTCGCCCTCCGCGGACTGG + Intergenic
979674692 4:123398406-123398428 CCGCCTCGCCCTCCCCGCCGCGG + Intronic
984803836 4:183736067-183736089 CCCCCTCCCCCTTCCCGGACAGG + Intergenic
986027621 5:3865507-3865529 CCGCTGCTCCCTCCCAGGAGAGG + Intergenic
990613325 5:57481991-57482013 CCGCATCCTCCTCACCGGAACGG - Exonic
996329333 5:122312003-122312025 CCGCGCCCCCGTCCCCGGCCGGG + Intronic
998463588 5:142326048-142326070 CCGCTCCCACTTCCCCGGAGGGG - Intronic
1003290874 6:4776904-4776926 CCGCGTCCCCTCCCCCGCCGCGG + Intronic
1003645589 6:7910832-7910854 CCCCGCGCCCCGCCCCGGAGAGG + Intronic
1003873728 6:10419902-10419924 CCCCGACCCCCACCCGGGAGTGG - Intergenic
1004562038 6:16760755-16760777 CCCATTCCTCCTCCCCGGAGAGG - Intronic
1005669503 6:28091052-28091074 CGGCGGCTCCCTCCCCGGAGGGG + Intergenic
1005947081 6:30602622-30602644 CCTCCACCCCCTCCCCGGGGAGG - Exonic
1006134925 6:31889338-31889360 CCTCCTCCCCCTTCCCAGAGTGG - Exonic
1006396076 6:33788604-33788626 CAGCGTCTCCCGCCCCGGCGCGG - Exonic
1007818037 6:44538685-44538707 ACTCTTCACCCTCCCCGGAGTGG + Intergenic
1011454075 6:87527905-87527927 CCGCCTCCCCATCCCCCGACAGG - Intronic
1015995053 6:138988340-138988362 CCTCCTCCCTCTCCCGGGAGCGG - Intergenic
1017474892 6:154780520-154780542 CCTCGTCCCCCACCCCCGACTGG + Intronic
1018141009 6:160837334-160837356 CCACATTCTCCTCCCCGGAGCGG - Intergenic
1018694578 6:166382196-166382218 CCGGGTCACCCTGCCCTGAGGGG + Intronic
1018818090 6:167350951-167350973 CCACGATCCCCTCCCCGGAGCGG + Intronic
1019343359 7:518652-518674 CCAGCTCCCCTTCCCCGGAGAGG + Intronic
1019525973 7:1480746-1480768 CCCCGTCCCCCTCCCCAGGCTGG + Intronic
1019571313 7:1713740-1713762 TCGCCCCCCCCTCCCCAGAGAGG - Intronic
1020238495 7:6374584-6374606 CCGCCTCGCCCTCCGCGGACTGG - Exonic
1021735453 7:23637009-23637031 CCCCCTCCCCCTTCCCGGACGGG - Intronic
1022655840 7:32318816-32318838 CCGTGTCGCCCTTCCCGTAGAGG - Intergenic
1022723078 7:32957833-32957855 GCGCGTCCCTCTCTCCGGACAGG + Intronic
1023638763 7:42237839-42237861 CCGGGTCCCCAAGCCCGGAGTGG + Intronic
1023945243 7:44797441-44797463 CCGTGTCCCCCACCCCCAAGCGG + Intronic
1024471747 7:49773756-49773778 CCCCGAACCCCTCCGCGGAGAGG + Exonic
1025011464 7:55402305-55402327 CCCCGCCTCCCTCCCCGGACGGG + Intronic
1025708348 7:63886938-63886960 CCTCTTCCCTCTCCCAGGAGGGG + Intergenic
1028773647 7:94655921-94655943 CCGCCTCCCCCTCCCCCGCTCGG - Intronic
1029068019 7:97872055-97872077 CCGCTGCCTCCTCTCCGGAGCGG + Intronic
1033601364 7:142891293-142891315 CCGCGCCCCCATCCCTGGGGTGG - Intergenic
1035127199 7:156616948-156616970 CCGTGTCCCCCTCCCCAGCCGGG + Intergenic
1035277716 7:157758040-157758062 CCGCGTCCCCCGCACCGGCAAGG - Intronic
1035512948 8:206338-206360 ACGCCTCCGCGTCCCCGGAGGGG + Intergenic
1035751875 8:2002134-2002156 GCGCGTCCGCGTCCCCCGAGGGG - Exonic
1038002557 8:23403916-23403938 GCGCCACCCCCTCCCCGAAGCGG - Intronic
1041059389 8:54021917-54021939 CCGCGCCCGCGTCCCCGGGGAGG - Intronic
1043502696 8:80873486-80873508 GCCCGTCCCCCTCCCCGGGCTGG + Intronic
1045432195 8:102124340-102124362 CCGCGCCCCCCTCCCCAGCCTGG + Intronic
1046586125 8:116150238-116150260 CAGCTTCCCCATCCCAGGAGGGG - Intergenic
1047400055 8:124538889-124538911 CCGCGCCCTCCTCCACTGAGCGG + Intronic
1047756953 8:127926335-127926357 CCAGGTCCCCCTCCCTGGACCGG + Intergenic
1049487984 8:142876395-142876417 CTGCCTCCCGCTCCCCGGATAGG - Exonic
1050472613 9:6008207-6008229 CTGCGGCCCCCTCCGGGGAGGGG - Intergenic
1053550921 9:39078721-39078743 CGGCGTCCGGCTCCCCGGCGCGG - Exonic
1053815030 9:41898800-41898822 CGGCGTCCGGCTCCCCGGCGCGG - Exonic
1054615566 9:67288641-67288663 CGGCGTCCGGCTCCCCGGCGCGG + Intergenic
1056356520 9:85805763-85805785 CCGCGGCCCCTTCCGCGGAGCGG - Intergenic
1056773929 9:89498014-89498036 CCGCCACCCCCTCCCCGGCCCGG - Intronic
1060208232 9:121694968-121694990 CCGCGGCTCCCTCCCCAGATGGG - Intronic
1060700507 9:125746651-125746673 CCCCGTCCCTCCCCCCGGCGCGG + Intergenic
1061727892 9:132591071-132591093 CTGCGCCCACCTCCCCAGAGAGG - Intergenic
1062005793 9:134237822-134237844 CCGCGTGCCCACCCCAGGAGTGG - Intergenic
1062084686 9:134642489-134642511 CCGCCGCCCCCTCCCCAGACGGG + Intronic
1062253495 9:135609709-135609731 TGGCGTGCCCCTCCCCGCAGCGG - Intergenic
1062653407 9:137590076-137590098 CAGCGTCCCCCGCCCCGCTGGGG + Intronic
1203468236 Un_GL000220v1:105764-105786 CCGCCGCCCCTTCCCCGGAGTGG + Intergenic
1203470560 Un_GL000220v1:113915-113937 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1203476057 Un_GL000220v1:149736-149758 CCGCCGCCCCTTCCCCGGAGTGG + Intergenic
1203478381 Un_GL000220v1:157887-157909 CCTCCTCCTCCTCCCCGGAGGGG + Intergenic
1185463164 X:341538-341560 CCTCCACCTCCTCCCCGGAGAGG - Intronic
1186525546 X:10244854-10244876 CAGCCACCCCCTTCCCGGAGAGG + Intergenic
1187648495 X:21374969-21374991 CCGCCTCACCCTCCCCGCAGCGG - Intronic
1190390136 X:49923122-49923144 CTGCGTCCCCTTTCCCGGACTGG + Intronic
1192657127 X:73003486-73003508 CCGCCTCCGCCTCCCCCAAGGGG - Intergenic
1192664993 X:73079515-73079537 CCGCCTCCGCCTCCCCCAAGGGG + Intergenic
1193152484 X:78139684-78139706 CCTCCTCCCGCTCCCCGCAGGGG - Exonic
1197774420 X:130110387-130110409 CCGCGTCTCGGCCCCCGGAGCGG - Exonic
1200003229 X:153072615-153072637 CAGCGTCCCCCTCCCCGGGTGGG - Intronic
1200004494 X:153077394-153077416 CAGCGTCCCCCTCCCCGGGTGGG + Intergenic
1200057722 X:153470408-153470430 CCCGGTCCCCCGCCCTGGAGTGG + Intronic
1200084797 X:153598904-153598926 CCGCGGCCCGCTTCGCGGAGCGG - Intronic
1200100698 X:153688111-153688133 CCGCGCCCCCCGCCCCGGCCGGG - Exonic
1200117510 X:153775796-153775818 CCTCGTCTCCAGCCCCGGAGAGG - Intronic