ID: 1134121239

View in Genome Browser
Species Human (GRCh38)
Location 16:11586547-11586569
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134121226_1134121239 4 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121239 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG No data
1134121223_1134121239 28 Left 1134121223 16:11586496-11586518 CCTGAGTCACTAGAGAGAATCGC No data
Right 1134121239 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr