ID: 1134121240

View in Genome Browser
Species Human (GRCh38)
Location 16:11586550-11586572
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134121232_1134121240 -9 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121240 16:11586550-11586572 CTCCGGGGAGGGGGACGCGGCGG No data
1134121230_1134121240 -8 Left 1134121230 16:11586535-11586557 CCCAGGGGCCGTCCTCTCCGGGG No data
Right 1134121240 16:11586550-11586572 CTCCGGGGAGGGGGACGCGGCGG No data
1134121226_1134121240 7 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121240 16:11586550-11586572 CTCCGGGGAGGGGGACGCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr