ID: 1134121242

View in Genome Browser
Species Human (GRCh38)
Location 16:11586552-11586574
Sequence GCCCGCCGCGTCCCCCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134121242_1134121252 8 Left 1134121242 16:11586552-11586574 CCGGGGAGGGGGACGCGGCGGGC No data
Right 1134121252 16:11586583-11586605 GCGCTCGTTCGGGTGGGGGCCGG No data
1134121242_1134121245 -3 Left 1134121242 16:11586552-11586574 CCGGGGAGGGGGACGCGGCGGGC No data
Right 1134121245 16:11586572-11586594 GGCCGCGAAGGGCGCTCGTTCGG No data
1134121242_1134121251 4 Left 1134121242 16:11586552-11586574 CCGGGGAGGGGGACGCGGCGGGC No data
Right 1134121251 16:11586579-11586601 AAGGGCGCTCGTTCGGGTGGGGG No data
1134121242_1134121248 1 Left 1134121242 16:11586552-11586574 CCGGGGAGGGGGACGCGGCGGGC No data
Right 1134121248 16:11586576-11586598 GCGAAGGGCGCTCGTTCGGGTGG No data
1134121242_1134121249 2 Left 1134121242 16:11586552-11586574 CCGGGGAGGGGGACGCGGCGGGC No data
Right 1134121249 16:11586577-11586599 CGAAGGGCGCTCGTTCGGGTGGG No data
1134121242_1134121250 3 Left 1134121242 16:11586552-11586574 CCGGGGAGGGGGACGCGGCGGGC No data
Right 1134121250 16:11586578-11586600 GAAGGGCGCTCGTTCGGGTGGGG No data
1134121242_1134121246 -2 Left 1134121242 16:11586552-11586574 CCGGGGAGGGGGACGCGGCGGGC No data
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134121242 Original CRISPR GCCCGCCGCGTCCCCCTCCC CGG (reversed) Intronic
No off target data available for this crispr