ID: 1134121246

View in Genome Browser
Species Human (GRCh38)
Location 16:11586573-11586595
Sequence GCCGCGAAGGGCGCTCGTTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134121238_1134121246 3 Left 1134121238 16:11586547-11586569 CCTCTCCGGGGAGGGGGACGCGG 0: 1
1: 0
2: 1
3: 39
4: 200
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data
1134121230_1134121246 15 Left 1134121230 16:11586535-11586557 CCCAGGGGCCGTCCTCTCCGGGG No data
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data
1134121242_1134121246 -2 Left 1134121242 16:11586552-11586574 CCGGGGAGGGGGACGCGGCGGGC No data
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data
1134121237_1134121246 7 Left 1134121237 16:11586543-11586565 CCGTCCTCTCCGGGGAGGGGGAC No data
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data
1134121226_1134121246 30 Left 1134121226 16:11586520-11586542 CCTTTTTCTAAAAAGCCCAGGGG No data
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data
1134121232_1134121246 14 Left 1134121232 16:11586536-11586558 CCAGGGGCCGTCCTCTCCGGGGA No data
Right 1134121246 16:11586573-11586595 GCCGCGAAGGGCGCTCGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134121246 Original CRISPR GCCGCGAAGGGCGCTCGTTC GGG Intronic
No off target data available for this crispr