ID: 1134121517

View in Genome Browser
Species Human (GRCh38)
Location 16:11587363-11587385
Sequence GCTCCCGGCCCTCTGGAGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 213}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134121500_1134121517 23 Left 1134121500 16:11587317-11587339 CCAGGCGGCGGGACCACCAACCT 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 213
1134121510_1134121517 -5 Left 1134121510 16:11587345-11587367 CCGGACCCGCGCTGGGGCGCTCC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 213
1134121502_1134121517 10 Left 1134121502 16:11587330-11587352 CCACCAACCTCGACCCCGGACCC 0: 1
1: 0
2: 0
3: 17
4: 254
Right 1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 213
1134121504_1134121517 3 Left 1134121504 16:11587337-11587359 CCTCGACCCCGGACCCGCGCTGG 0: 1
1: 0
2: 0
3: 25
4: 199
Right 1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 213
1134121499_1134121517 29 Left 1134121499 16:11587311-11587333 CCACTTCCAGGCGGCGGGACCAC 0: 1
1: 0
2: 0
3: 4
4: 75
Right 1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 213
1134121508_1134121517 -3 Left 1134121508 16:11587343-11587365 CCCCGGACCCGCGCTGGGGCGCT 0: 1
1: 0
2: 0
3: 8
4: 91
Right 1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 213
1134121503_1134121517 7 Left 1134121503 16:11587333-11587355 CCAACCTCGACCCCGGACCCGCG 0: 1
1: 0
2: 1
3: 5
4: 115
Right 1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 213
1134121509_1134121517 -4 Left 1134121509 16:11587344-11587366 CCCGGACCCGCGCTGGGGCGCTC 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 213
1134121512_1134121517 -10 Left 1134121512 16:11587350-11587372 CCCGCGCTGGGGCGCTCCCGGCC 0: 1
1: 0
2: 0
3: 26
4: 223
Right 1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG 0: 1
1: 0
2: 2
3: 24
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134121517 Original CRISPR GCTCCCGGCCCTCTGGAGGG CGG Exonic
900205831 1:1431516-1431538 GCTCCTGGCCCTCAGGCTGGGGG - Intergenic
900209037 1:1444494-1444516 GGGCCCGGCCTTCAGGAGGGAGG - Intergenic
900746823 1:4366299-4366321 GCCCCGGGCCCTCTGCAGCGGGG - Intergenic
901211038 1:7526250-7526272 GCTCCAGGGGCTCTGGAGGCTGG + Intronic
901642108 1:10697898-10697920 GCTCCGGGGCCGATGGAGGGAGG + Intronic
902992736 1:20200619-20200641 GCTCCCAGCCCAGTGCAGGGAGG + Intergenic
903178618 1:21594647-21594669 GATGCCGGCCCTGTGGAGGTGGG + Intergenic
903281655 1:22253591-22253613 CCTCCCGGGGCTCTGGAAGGAGG + Intergenic
905044557 1:34985417-34985439 CCTCGCGACCCCCTGGAGGGTGG - Intronic
905222409 1:36457784-36457806 GCTCCAAGTCCTCTGGAGGCAGG + Intronic
906147008 1:43566150-43566172 GCTGCCGGCCCTCTCGCGCGCGG + Intronic
907322943 1:53617039-53617061 GCTCTAGGCCCTCTGGAGGAGGG - Intronic
908234646 1:62137790-62137812 CCTCCCCGTCCTCTGGTGGGAGG + Intronic
912270172 1:108200404-108200426 ACTTCCGGCTCTCTGGAGGCGGG - Intronic
912711606 1:111953968-111953990 GCTCCCTGCCCTCCACAGGGAGG + Intronic
914322221 1:146576246-146576268 GCTCCTGGCACTCAGGAGAGAGG - Intergenic
915317402 1:155036869-155036891 ACTCCCAGCCTGCTGGAGGGAGG - Intronic
919755394 1:201062973-201062995 GCTCCCGCCCCACTGGCAGGAGG - Intronic
924611932 1:245580583-245580605 CCCCCTTGCCCTCTGGAGGGAGG - Intronic
1064124454 10:12647873-12647895 GCTGCCGGCTCTCAGGAGGAGGG - Intronic
1065698968 10:28406145-28406167 GCTCTCTGGCCTCTGGAGAGTGG + Intergenic
1065868034 10:29930630-29930652 GATCCCTGCCTTCTGTAGGGAGG - Intergenic
1066374423 10:34844488-34844510 GCTTCTGTCCCTGTGGAGGGAGG - Intergenic
1069590329 10:69637411-69637433 GCTCCAGTCCCTCTGGTGGGCGG + Intergenic
1069703367 10:70441778-70441800 GCCCCCCACCCTCCGGAGGGGGG - Intronic
1069881898 10:71598431-71598453 GCTCCGGGCCCTCTCCAGGAGGG + Intronic
1069916365 10:71789509-71789531 GATTCTGTCCCTCTGGAGGGAGG - Intronic
1073206836 10:101774183-101774205 GCTCCCGGCTCCCTGTGGGGTGG - Intronic
1073399092 10:103242112-103242134 CCTCCTGGCCCTCGTGAGGGTGG - Intergenic
1075277187 10:121104732-121104754 GTTGCCTGCCCACTGGAGGGTGG - Intergenic
1075632733 10:124010962-124010984 ACGCCCCGCCCTCTGGAGTGAGG + Intronic
1075632749 10:124011027-124011049 ACGCCCCGCCCTCTGGAGTGAGG + Intronic
1076462579 10:130656678-130656700 GCCTCCGTGCCTCTGGAGGGTGG - Intergenic
1076809617 10:132879754-132879776 GCTGCCGGCCCTCAGCAGAGTGG - Intronic
1077107971 11:850070-850092 GCTCCTTGCCCTCCGGAGAGGGG - Intronic
1077250733 11:1559540-1559562 GCTCCCAGCCAGCTGGAGGCAGG - Intronic
1077327341 11:1969434-1969456 CCTCCCGGCCCTGGGCAGGGGGG + Intronic
1077375928 11:2205096-2205118 GCTCCCTGCCCTCTGGCAGGAGG - Intergenic
1078699761 11:13669013-13669035 GGTCCCGGCCCTGTGAAGGGCGG - Intronic
1078729432 11:13962441-13962463 ACTCCGGACCCTCTGGAGGACGG - Intergenic
1081589068 11:44408313-44408335 GGGCCCGGAGCTCTGGAGGGAGG - Intergenic
1081668740 11:44931731-44931753 TCTCCCTGTGCTCTGGAGGGAGG - Exonic
1082085141 11:48043971-48043993 TCTCCCCTCCCTCTGAAGGGAGG + Intronic
1083261494 11:61525453-61525475 GCGCCCGGCCCTGAGGCGGGAGG - Intronic
1084274321 11:68043914-68043936 GCCCCCGGCCTTCCGGAGGCGGG + Intronic
1084428413 11:69097954-69097976 GCTCAGGGCCACCTGGAGGGTGG - Intergenic
1084483371 11:69434601-69434623 GCCCCAGGCCCTGGGGAGGGAGG + Intergenic
1085028833 11:73257637-73257659 GCTCCTGGACCTCAGGAAGGAGG + Intergenic
1087289028 11:96299645-96299667 GCTCCGGTGCCTCTGGAGGGAGG + Intronic
1202810323 11_KI270721v1_random:24614-24636 CCTCCCGGCCCTGGGCAGGGGGG + Intergenic
1091780761 12:3213324-3213346 GCCCCCTGCCCTCTCAAGGGGGG + Intronic
1092256333 12:6928316-6928338 GCTCCGGCGCCTCTGGGGGGCGG - Intronic
1095996027 12:48085372-48085394 GCCCCTGGCCCTCCGCAGGGTGG - Intronic
1096474114 12:51897446-51897468 GCTCCAGCCACTCTGGTGGGTGG - Intergenic
1096670450 12:53195516-53195538 GCTCCCGGAGGTCTGGAAGGAGG + Intronic
1097083353 12:56449343-56449365 GCCACCGGCCCTCTGGCGCGGGG + Exonic
1098045801 12:66399199-66399221 GCTCCTGGCACGGTGGAGGGAGG - Intronic
1101955723 12:109211102-109211124 CCTTCCTGCCCTCTGGTGGGAGG + Intronic
1104544620 12:129699971-129699993 GCTCCCGATCCTCTGCAAGGGGG + Exonic
1104687061 12:130793375-130793397 GCGCGCCTCCCTCTGGAGGGAGG - Intronic
1104775579 12:131388398-131388420 TCTCCCTGTCCCCTGGAGGGTGG - Intergenic
1104946208 12:132415889-132415911 GCTCCCACCCCACTGGAGGACGG + Intergenic
1111738863 13:92176696-92176718 GCTCCAGGCACTCTGGAGGGAGG - Intronic
1114493356 14:23117024-23117046 GCTCCAGGTCCTGTGGGGGGCGG + Intergenic
1121231564 14:92362433-92362455 GCTCCCAGCCCACTGGAGAGTGG - Intronic
1121323316 14:93005476-93005498 GCTCCAGGCCCTGGGAAGGGTGG - Intronic
1121634572 14:95445183-95445205 GCACCAGGCCCTGTGGATGGAGG + Intronic
1122549882 14:102544185-102544207 ACACCCGCCCCTCTGGGGGGTGG - Intergenic
1122699992 14:103581912-103581934 CCTCCCTGCTCTGTGGAGGGAGG + Intronic
1122785592 14:104161991-104162013 GCCCACGGCCCTGTGGAGGCAGG - Intronic
1123632919 15:22274571-22274593 GCTGCAGGCCCTGTGGAGGGAGG - Intergenic
1123758741 15:23416790-23416812 GCGCCCCGCCCTGTGGAGTGAGG + Intergenic
1123769863 15:23518453-23518475 GGTCTCGGCCATCTGGAGGGTGG - Intergenic
1124652986 15:31486603-31486625 GCCCCGGACCCTCTGGAGGCAGG + Intronic
1124858331 15:33412522-33412544 TCTCCCTGCCCTCTGGAGAAAGG + Intronic
1129450294 15:75647738-75647760 GCCCCGGGCCCGCGGGAGGGCGG + Intronic
1130062676 15:80580985-80581007 GATCCGGGCCCTCTGGAGTCTGG - Intronic
1131177938 15:90221495-90221517 GATCCCTGCCCTCTGGGTGGTGG - Intronic
1131888788 15:96949645-96949667 GGCGCTGGCCCTCTGGAGGGTGG - Intergenic
1132858861 16:2060201-2060223 GCTCACAGCTCCCTGGAGGGTGG + Intronic
1132982789 16:2747358-2747380 GCTCCGGGCGCTCTGCAGAGTGG + Intergenic
1134081367 16:11327268-11327290 GCTCCGGGCCTTCTGTGGGGTGG + Intronic
1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG + Exonic
1134243341 16:12521964-12521986 GCTGCCACCCCTCTGGAGGAAGG + Intronic
1135561887 16:23483055-23483077 GCTCCTGGGGCCCTGGAGGGGGG - Intronic
1136044062 16:27601799-27601821 GCTGCCGGCCCCCTGAAGAGGGG - Intronic
1137789808 16:51165550-51165572 GCTCCTGGCTCTCAGGAAGGTGG - Intergenic
1138202039 16:55096314-55096336 GCCCCCAGCCATCTGGAGGAGGG - Intergenic
1140011405 16:71134922-71134944 GCTCCTGGCACTCAGGAGAGAGG + Intronic
1140512449 16:75517752-75517774 ACTCCCAGCACTCTGGGGGGAGG + Intergenic
1140833798 16:78775038-78775060 GCTCCCCACCCTCAGGAGTGAGG - Intronic
1141163878 16:81647656-81647678 GCTCCAGGCTCCCTGGAGGCTGG - Intronic
1141423907 16:83933437-83933459 GCTGCCGGCCCTGTAGAGGTGGG - Intronic
1141605973 16:85153613-85153635 GCTCCCTGCCCTCTGCAGAAAGG - Intergenic
1141796960 16:86281532-86281554 GCTCCGGGCCAGCTGGAAGGAGG + Intergenic
1142699218 17:1649336-1649358 GCGCGCGGCCCGCGGGAGGGAGG + Intronic
1142806117 17:2372136-2372158 GCTGCGGCCCCTCTGGTGGGAGG - Intronic
1144636113 17:16910269-16910291 ACTCAGGGCCCACTGGAGGGAGG - Intergenic
1144645956 17:16973557-16973579 ACTCAGGGCCCACTGGAGGGAGG + Intergenic
1146789796 17:35744907-35744929 GTTGCAGGCCCTCTGGAGGTTGG + Exonic
1148214304 17:45826043-45826065 GCACCCCGCCCTAAGGAGGGTGG - Intronic
1148231182 17:45936011-45936033 GCTCTCTGCCCTCTGGGGGTTGG - Intronic
1148550038 17:48544708-48544730 GCTCCTGGGTCTCTGAAGGGTGG + Exonic
1150389258 17:64781206-64781228 GCTGCCCTCCCTCTGGAGGCGGG - Intergenic
1151343228 17:73485225-73485247 CCTTCCTGCCCTCAGGAGGGAGG - Intronic
1151733894 17:75926994-75927016 GCCCCCTGGCATCTGGAGGGTGG + Intronic
1152084939 17:78212257-78212279 GTTGCCTGCCCTCAGGAGGGAGG - Intergenic
1152137043 17:78510605-78510627 GATCCCGGGCTGCTGGAGGGAGG + Intronic
1152655416 17:81517175-81517197 GCTCCAGGCCTTCTGGAGACAGG + Intronic
1154493513 18:14939278-14939300 GCTCCTGTCCCTCTGGGGGCAGG - Intergenic
1156020437 18:32594158-32594180 GCTCCCTGCCAGCTGGAGGATGG - Intergenic
1157221052 18:45828731-45828753 GCTCCCTGCCCACTGCAGGAGGG - Intronic
1157815586 18:50727573-50727595 CCTCCAGGCTCTCTGGAGGAAGG - Intronic
1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG + Intronic
1160734623 19:656912-656934 GCTCCCGGTCAGCTGGCGGGCGG - Intronic
1160790255 19:919771-919793 GCGCCCGGGCCTTTGCAGGGTGG + Intronic
1160799234 19:960176-960198 GCCCCCACCCCGCTGGAGGGAGG + Intronic
1160985260 19:1835735-1835757 GCTCCCAGGCCTCTGGAGGTAGG - Intronic
1161210025 19:3061547-3061569 CCTCCCGGCGCTTTGGAGGGCGG - Intronic
1161397386 19:4051981-4052003 GCTCCCAGGCTTTTGGAGGGTGG + Intronic
1161512525 19:4679549-4679571 GCTCCGGGCCTAATGGAGGGAGG - Intronic
1164840390 19:31388696-31388718 GCTCCCTGCCCTCCAGAGGTTGG + Intergenic
1167743955 19:51340288-51340310 GGTCCGGGCCGTCTGGAGGGAGG + Exonic
925081129 2:1067926-1067948 ACTCCCGGACCTCGGGAGTGGGG + Intronic
926194235 2:10752453-10752475 TCTCCCCGCCCTCAGGAGGGAGG - Intronic
927095691 2:19746181-19746203 GCTCCCAGCACACTGGAGGGTGG + Intergenic
930946758 2:57084779-57084801 GCTCCCGGCACCCAAGAGGGAGG + Intergenic
932462559 2:71892507-71892529 GCTCCTGGCCCTCTTGTGGAAGG - Intergenic
936414247 2:112289856-112289878 GCTCCAGCCACTCTGGAGGCTGG - Intronic
941784156 2:169479705-169479727 GCTCGCGGCCCTGGTGAGGGTGG + Intronic
942450692 2:176106655-176106677 GCTCCCTGCGCCCTGGAGAGTGG + Intronic
943152985 2:184138060-184138082 GGTCCCAGCACTCTGAAGGGTGG + Intergenic
943674659 2:190705185-190705207 GCTCCCAGCCCTGGGGAGTGAGG - Intergenic
947524931 2:230871997-230872019 TCTCCCTTCCCCCTGGAGGGGGG - Intronic
947669982 2:231929866-231929888 CCTTCTGGCCCTCTGAAGGGCGG + Intergenic
948865184 2:240771538-240771560 GCTCCCAGCCCTCAGGTGTGGGG - Intronic
1170004005 20:11646516-11646538 TCCACCGGCCCTCTGGAGCGTGG - Intergenic
1170972924 20:21133483-21133505 GCTCCTGGCCTTCTGGTGGTGGG + Intronic
1171433577 20:25102771-25102793 CCTATGGGCCCTCTGGAGGGAGG + Intergenic
1172694522 20:36812953-36812975 GGTCCCAGCCCTCAGGTGGGTGG - Intronic
1172700706 20:36852169-36852191 GCTCCCGTTCCTCTGTAGTGTGG - Intronic
1173648608 20:44649280-44649302 GCTCCCTGCCCTCTTGTGGGAGG - Intronic
1174276633 20:49408984-49409006 GCTCCTGGGCCTGTGGAGGCAGG + Intronic
1175108113 20:56628735-56628757 GGTCCCGGCCCCCGGGCGGGAGG - Intergenic
1175479346 20:59300530-59300552 GTTCCAGCCCCTCTGGGGGGCGG + Exonic
1175859840 20:62144069-62144091 GCACCCGGCCGTGTGGGGGGCGG + Intronic
1175875839 20:62228912-62228934 GCTCAGGGCCTTGTGGAGGGAGG - Intergenic
1175951966 20:62588391-62588413 GCGCCCGGCCCTCTGGAGCTGGG + Intergenic
1176222777 20:63978039-63978061 GCTGCAGGCCCTGTGGGGGGCGG - Intronic
1179248673 21:39655408-39655430 GCTCCCTGCCCACTGGAGGTGGG - Intronic
1179654627 21:42837639-42837661 GCTGCCGGCCAGCGGGAGGGAGG - Intergenic
1180042760 21:45288392-45288414 GCTCTCGCCCCTCTGGAGCTGGG + Intergenic
1180711291 22:17841440-17841462 GCACCGGGCCGTCTTGAGGGAGG - Intronic
1181285199 22:21747143-21747165 GCCCCCGGCCCTCTGTACTGTGG + Intergenic
1181339338 22:22165789-22165811 GCTCCTGGTGCCCTGGAGGGAGG + Intergenic
1183114321 22:35678160-35678182 GCTCCCAGCCTCCTGCAGGGAGG - Intergenic
1183466135 22:37981308-37981330 GCTCCCTGGACCCTGGAGGGGGG - Intronic
1184172074 22:42765727-42765749 CCTCCCTTCCCCCTGGAGGGAGG + Intergenic
1184389059 22:44192603-44192625 GTTCCCTGCCCTCTGGGGAGTGG + Intronic
1184426065 22:44410022-44410044 GCTTCTGACCCTGTGGAGGGTGG - Intergenic
1185276703 22:49953057-49953079 CCTCCCAGCCCTCAGGAGGAGGG - Intergenic
1185351724 22:50343196-50343218 TCTCCGGGCCCCCTGGAGTGGGG - Intergenic
950011208 3:9725159-9725181 CATCCCAGCCCTCTGGAGTGAGG - Intronic
950424913 3:12919910-12919932 GCTCCCTGCCCTCAGGGAGGTGG - Intronic
950538309 3:13594629-13594651 GCTCCGTGGGCTCTGGAGGGAGG + Intronic
951915186 3:27793184-27793206 GCTCCCAGCACCCTGGTGGGAGG + Intergenic
953032104 3:39185895-39185917 GCTCCCCGCCCACTCCAGGGAGG - Exonic
954210353 3:49093734-49093756 GCACCCCGCCCTGTGGATGGGGG - Intronic
960560051 3:119073655-119073677 GCTCCCGGCCCTGGGCAGTGAGG - Intronic
961010048 3:123429675-123429697 GCCCCCTGCCCTCTTGAGGATGG - Intronic
961574297 3:127822524-127822546 GCTCCCCGCCCTGGGGAGGGAGG - Exonic
962068470 3:132009015-132009037 GGGCCCTGCCCTCAGGAGGGAGG + Intronic
963799107 3:149658884-149658906 GCTCCAGGCTCCCCGGAGGGCGG - Intronic
968522379 4:1039861-1039883 CCTGCCGGCCCTGTGGAGGGTGG + Intergenic
968866278 4:3214044-3214066 GCTGCCTGGCCTCTGGAGCGTGG + Exonic
969529069 4:7719820-7719842 GGTCCCGGCCCCCTGGGCGGTGG - Intronic
972048033 4:34693769-34693791 GTTCCCTGACCTGTGGAGGGAGG - Intergenic
974069301 4:57109926-57109948 GCTCTCGGCCCTCTGGCTGGCGG + Exonic
978165632 4:105603364-105603386 GCTCCTGACCCTCGGGAGGATGG + Intronic
981391499 4:144196691-144196713 GCCCCCGGCCCTCTGATGGAAGG - Intergenic
981660287 4:147158390-147158412 GCTCCCGGCCGTCCTGAGGCAGG + Intergenic
985986266 5:3518965-3518987 GCTCCCGGCCTGTTGCAGGGCGG - Intergenic
986813539 5:11384672-11384694 GCTGCCCGGCCTCTGGAGGGTGG + Exonic
990866534 5:60386546-60386568 GCTTCCGTTCCTCTGCAGGGGGG + Intronic
992130961 5:73692686-73692708 GGTCCCAGCCTTCTGCAGGGAGG + Intronic
994076225 5:95652888-95652910 GCTCCCGGCTCTGTGGAGAATGG - Intronic
995853656 5:116572737-116572759 GATCCCGGCCCTTTGGAGAGTGG - Intronic
997435366 5:133870280-133870302 TCTCCCTGCCCTCTGGAAGGTGG + Intergenic
997965380 5:138352568-138352590 GCCCCCCGCGCTCTGGAGCGGGG - Intergenic
1001309683 5:170601999-170602021 GCTCTCTGCCCTCTGGGGTGAGG + Intronic
1001646051 5:173283210-173283232 GCTCCCTGCCCTAGAGAGGGAGG + Intergenic
1001656646 5:173355836-173355858 CCTCCCGGCCATCTGTGGGGAGG + Intergenic
1002563294 5:180096780-180096802 GCTCCTGGCCCTATGCAGGATGG - Intergenic
1002795071 6:465526-465548 CCTCCAGGCCCTCGGGTGGGAGG - Intergenic
1003599401 6:7503328-7503350 GCTCGCTGCCCTCTGTGGGGTGG + Intergenic
1006188007 6:32191446-32191468 GCTCTTGCCCCCCTGGAGGGAGG + Exonic
1006196778 6:32248080-32248102 GATCTCTGCCATCTGGAGGGTGG + Intergenic
1007482553 6:42159602-42159624 GCTTCCGGCTCACTGGAGGGCGG - Intronic
1007712722 6:43834908-43834930 GCCCCGTGCCCTGTGGAGGGAGG - Intergenic
1010053140 6:71531973-71531995 TTTCCCGGCTCTCTCGAGGGAGG - Intergenic
1022089131 7:27096405-27096427 GCTCCCGGCTCTCTCGGGGCGGG + Intergenic
1024426589 7:49232872-49232894 GCTCCTGGCCATCTGGCTGGAGG + Intergenic
1026009789 7:66628229-66628251 GCTCCCGGCTCCCTGGGAGGCGG - Intergenic
1026858359 7:73769427-73769449 GCTCCCGGGCCGGTGGAGCGCGG + Exonic
1027111318 7:75442287-75442309 GGTCCTGGCCCTCCGGAGCGGGG + Intronic
1027283559 7:76626846-76626868 GGTCCTGGCCCTCCGGAGCGGGG + Exonic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1028472280 7:91218505-91218527 GGTACATGCCCTCTGGAGGGTGG + Intergenic
1029441784 7:100590758-100590780 GCTGCTGGCCATCTGGTGGGTGG - Intronic
1029461383 7:100695637-100695659 GTTCCCGGCACTTTGGAAGGAGG - Intergenic
1032857374 7:135846544-135846566 GCTCCCTGCCCTCTGGCGTCTGG + Intergenic
1034835990 7:154351917-154351939 GCTCCCAGCCCTCTGGAAGGTGG + Intronic
1034980486 7:155472973-155472995 GCTCCCTGGCCTCAGCAGGGGGG + Intergenic
1035160131 7:156944133-156944155 GCGCCTGGCCCTCTGAATGGGGG + Intergenic
1035290453 7:157834714-157834736 GCTCCAGGCTCACTGGAGGCTGG - Intronic
1035325141 7:158061109-158061131 GCTGCCGGCTCACTGAAGGGTGG + Intronic
1035389363 7:158495471-158495493 GCGCCCTGCCCACTGCAGGGGGG + Intronic
1035741289 8:1930244-1930266 GCTCCCGGCCGTGGGGAGGGTGG - Intronic
1037404383 8:18525868-18525890 GCTGCCTGTCCTCTGGAGGTGGG - Intergenic
1037598635 8:20374800-20374822 GGTCCCAGCCCTGAGGAGGGAGG - Intergenic
1038332923 8:26623745-26623767 GTTCCCTGCCGTCTGGCGGGGGG + Intronic
1039430106 8:37519362-37519384 GCTCCCGGCTCTGTGGACAGGGG + Intergenic
1039455172 8:37701084-37701106 GCCCCCGGCCCGATGGAGCGGGG - Intergenic
1045002181 8:97888154-97888176 GCTCCCTGGCCTCGGCAGGGAGG - Exonic
1048018484 8:130518394-130518416 GCTAGCTGCCCTCTGGTGGGAGG + Intergenic
1049106289 8:140615481-140615503 GCTCAGAGCCCTCTGAAGGGTGG + Intronic
1049222535 8:141434519-141434541 GCTGCGGGAGCTCTGGAGGGAGG + Intergenic
1049389807 8:142361855-142361877 GCTCCCGGCGGTCTGCAGCGGGG - Intronic
1056957652 9:91095552-91095574 GCTCCCTGCCCTCTGGATTCAGG - Intergenic
1058967104 9:110048661-110048683 CCTCCGGGCGCGCTGGAGGGCGG - Exonic
1059438183 9:114288859-114288881 CCTCCCAGCCCTCTGCAGGATGG + Intronic
1060046982 9:120349146-120349168 GCCCCCGACCCTCTGAAGGAGGG + Intergenic
1061583881 9:131554451-131554473 GCTCCCAGCCCTCTGCAGCTGGG - Intergenic
1061950112 9:133931405-133931427 GCTCCCTGCCTGCAGGAGGGGGG - Intronic
1062381999 9:136291056-136291078 GCTCCCAGGCCTCTGGGAGGAGG + Exonic
1187154605 X:16711979-16712001 TCTCCCGGCCCTCGGGAGCCAGG - Exonic
1189232749 X:39465249-39465271 GCTTCTTGCCCTCTGGTGGGAGG - Intergenic
1192274575 X:69616271-69616293 GCTCCCGGGCCTCAAGAGAGTGG + Exonic
1195206179 X:102601928-102601950 GGGCCCAGCCCTGTGGAGGGTGG - Exonic
1200135588 X:153873127-153873149 GGCCCCGGCACTCAGGAGGGCGG + Intronic