ID: 1134123426

View in Genome Browser
Species Human (GRCh38)
Location 16:11600437-11600459
Sequence GGGACCCGGCCCATCTGCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134123426_1134123432 2 Left 1134123426 16:11600437-11600459 CCTAGGCAGATGGGCCGGGTCCC No data
Right 1134123432 16:11600462-11600484 GCGCAACCCCACCTCCAAGTGGG No data
1134123426_1134123431 1 Left 1134123426 16:11600437-11600459 CCTAGGCAGATGGGCCGGGTCCC No data
Right 1134123431 16:11600461-11600483 AGCGCAACCCCACCTCCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134123426 Original CRISPR GGGACCCGGCCCATCTGCCT AGG (reversed) Intronic
No off target data available for this crispr