ID: 1134125334

View in Genome Browser
Species Human (GRCh38)
Location 16:11612425-11612447
Sequence AGGCAGGTGAAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134125326_1134125334 6 Left 1134125326 16:11612396-11612418 CCTCCCTGGCTTGGCCTGGGCTC No data
Right 1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG No data
1134125327_1134125334 3 Left 1134125327 16:11612399-11612421 CCCTGGCTTGGCCTGGGCTCTCT No data
Right 1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG No data
1134125325_1134125334 7 Left 1134125325 16:11612395-11612417 CCCTCCCTGGCTTGGCCTGGGCT No data
Right 1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG No data
1134125328_1134125334 2 Left 1134125328 16:11612400-11612422 CCTGGCTTGGCCTGGGCTCTCTG No data
Right 1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG No data
1134125332_1134125334 -8 Left 1134125332 16:11612410-11612432 CCTGGGCTCTCTGGAAGGCAGGT No data
Right 1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134125334 Original CRISPR AGGCAGGTGAAGAATGAGGA AGG Intronic
No off target data available for this crispr