ID: 1134127632

View in Genome Browser
Species Human (GRCh38)
Location 16:11627296-11627318
Sequence CTGCTGGCAAAGATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134127632_1134127637 -5 Left 1134127632 16:11627296-11627318 CCCAGCACCATCTTTGCCAGCAG No data
Right 1134127637 16:11627314-11627336 AGCAGGTAGAGCAAGCCCACTGG No data
1134127632_1134127642 30 Left 1134127632 16:11627296-11627318 CCCAGCACCATCTTTGCCAGCAG No data
Right 1134127642 16:11627349-11627371 ACACAGAGAACAGCCAGGCTTGG No data
1134127632_1134127640 25 Left 1134127632 16:11627296-11627318 CCCAGCACCATCTTTGCCAGCAG No data
Right 1134127640 16:11627344-11627366 AGCCAACACAGAGAACAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134127632 Original CRISPR CTGCTGGCAAAGATGGTGCT GGG (reversed) Intronic
No off target data available for this crispr