ID: 1134130072

View in Genome Browser
Species Human (GRCh38)
Location 16:11643151-11643173
Sequence TTGGCTATTCCAAGGCATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134130072_1134130080 27 Left 1134130072 16:11643151-11643173 CCCTGATGCCTTGGAATAGCCAA No data
Right 1134130080 16:11643201-11643223 AGGACTGACTCTATGTTAAAGGG No data
1134130072_1134130077 7 Left 1134130072 16:11643151-11643173 CCCTGATGCCTTGGAATAGCCAA No data
Right 1134130077 16:11643181-11643203 CTGCGACACTTACTTACACCAGG No data
1134130072_1134130079 26 Left 1134130072 16:11643151-11643173 CCCTGATGCCTTGGAATAGCCAA No data
Right 1134130079 16:11643200-11643222 CAGGACTGACTCTATGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134130072 Original CRISPR TTGGCTATTCCAAGGCATCA GGG (reversed) Intergenic
No off target data available for this crispr