ID: 1134131641

View in Genome Browser
Species Human (GRCh38)
Location 16:11654357-11654379
Sequence CCAGGGGAGCAGTGGGCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134131641_1134131649 -8 Left 1134131641 16:11654357-11654379 CCATCTGCCCACTGCTCCCCTGG No data
Right 1134131649 16:11654372-11654394 TCCCCTGGGGTGGGACCAACAGG No data
1134131641_1134131654 16 Left 1134131641 16:11654357-11654379 CCATCTGCCCACTGCTCCCCTGG No data
Right 1134131654 16:11654396-11654418 AGTTCCCATAATATTCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134131641 Original CRISPR CCAGGGGAGCAGTGGGCAGA TGG (reversed) Intergenic
No off target data available for this crispr