ID: 1134132185

View in Genome Browser
Species Human (GRCh38)
Location 16:11657377-11657399
Sequence GTCCCCAAGGAGGTCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134132176_1134132185 -7 Left 1134132176 16:11657361-11657383 CCTCCAGGAGCCCCAGGTCCCCA No data
Right 1134132185 16:11657377-11657399 GTCCCCAAGGAGGTCTTGGGAGG No data
1134132174_1134132185 5 Left 1134132174 16:11657349-11657371 CCTGGGAGGAATCCTCCAGGAGC No data
Right 1134132185 16:11657377-11657399 GTCCCCAAGGAGGTCTTGGGAGG No data
1134132171_1134132185 20 Left 1134132171 16:11657334-11657356 CCTGGGCTGGGGCTGCCTGGGAG No data
Right 1134132185 16:11657377-11657399 GTCCCCAAGGAGGTCTTGGGAGG No data
1134132177_1134132185 -10 Left 1134132177 16:11657364-11657386 CCAGGAGCCCCAGGTCCCCAAGG No data
Right 1134132185 16:11657377-11657399 GTCCCCAAGGAGGTCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134132185 Original CRISPR GTCCCCAAGGAGGTCTTGGG AGG Intergenic
No off target data available for this crispr