ID: 1134134444

View in Genome Browser
Species Human (GRCh38)
Location 16:11669675-11669697
Sequence GCAAAGTTGTTTGGCCAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134134440_1134134444 3 Left 1134134440 16:11669649-11669671 CCACCAACTTTCTCCGGCATCTA No data
Right 1134134444 16:11669675-11669697 GCAAAGTTGTTTGGCCAAACAGG No data
1134134441_1134134444 0 Left 1134134441 16:11669652-11669674 CCAACTTTCTCCGGCATCTACAA No data
Right 1134134444 16:11669675-11669697 GCAAAGTTGTTTGGCCAAACAGG No data
1134134442_1134134444 -10 Left 1134134442 16:11669662-11669684 CCGGCATCTACAAGCAAAGTTGT No data
Right 1134134444 16:11669675-11669697 GCAAAGTTGTTTGGCCAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134134444 Original CRISPR GCAAAGTTGTTTGGCCAAAC AGG Intronic
No off target data available for this crispr