ID: 1134135382

View in Genome Browser
Species Human (GRCh38)
Location 16:11673606-11673628
Sequence ACCAGAAGTGGCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134135374_1134135382 8 Left 1134135374 16:11673575-11673597 CCAGGAGTGCCACCTGCCCCCAG No data
Right 1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG No data
1134135379_1134135382 -10 Left 1134135379 16:11673593-11673615 CCCAGTTGTGACAACCAGAAGTG No data
Right 1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG No data
1134135373_1134135382 19 Left 1134135373 16:11673564-11673586 CCTACTTGATGCCAGGAGTGCCA No data
Right 1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG No data
1134135378_1134135382 -9 Left 1134135378 16:11673592-11673614 CCCCAGTTGTGACAACCAGAAGT No data
Right 1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG No data
1134135376_1134135382 -4 Left 1134135376 16:11673587-11673609 CCTGCCCCCAGTTGTGACAACCA No data
Right 1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG No data
1134135370_1134135382 29 Left 1134135370 16:11673554-11673576 CCATGGTCTCCCTACTTGATGCC No data
Right 1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG No data
1134135375_1134135382 -1 Left 1134135375 16:11673584-11673606 CCACCTGCCCCCAGTTGTGACAA No data
Right 1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG No data
1134135377_1134135382 -8 Left 1134135377 16:11673591-11673613 CCCCCAGTTGTGACAACCAGAAG No data
Right 1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG No data
1134135372_1134135382 20 Left 1134135372 16:11673563-11673585 CCCTACTTGATGCCAGGAGTGCC No data
Right 1134135382 16:11673606-11673628 ACCAGAAGTGGCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134135382 Original CRISPR ACCAGAAGTGGCTCCAGACA TGG Intronic
No off target data available for this crispr