ID: 1134136950 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:11683335-11683357 |
Sequence | TTCACAGCAGTCTGCACGCA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1134136948_1134136950 | -10 | Left | 1134136948 | 16:11683322-11683344 | CCCATGGCGGACGTTCACAGCAG | No data | ||
Right | 1134136950 | 16:11683335-11683357 | TTCACAGCAGTCTGCACGCATGG | No data | ||||
1134136947_1134136950 | -6 | Left | 1134136947 | 16:11683318-11683340 | CCATCCCATGGCGGACGTTCACA | No data | ||
Right | 1134136950 | 16:11683335-11683357 | TTCACAGCAGTCTGCACGCATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1134136950 | Original CRISPR | TTCACAGCAGTCTGCACGCA TGG | Intronic | ||