ID: 1134136950

View in Genome Browser
Species Human (GRCh38)
Location 16:11683335-11683357
Sequence TTCACAGCAGTCTGCACGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134136948_1134136950 -10 Left 1134136948 16:11683322-11683344 CCCATGGCGGACGTTCACAGCAG No data
Right 1134136950 16:11683335-11683357 TTCACAGCAGTCTGCACGCATGG No data
1134136947_1134136950 -6 Left 1134136947 16:11683318-11683340 CCATCCCATGGCGGACGTTCACA No data
Right 1134136950 16:11683335-11683357 TTCACAGCAGTCTGCACGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134136950 Original CRISPR TTCACAGCAGTCTGCACGCA TGG Intronic