ID: 1134139559

View in Genome Browser
Species Human (GRCh38)
Location 16:11706315-11706337
Sequence TTGGCGCCACTCACCCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134139556_1134139559 -5 Left 1134139556 16:11706297-11706319 CCACAGCCAGCATGTCTCTTGGC No data
Right 1134139559 16:11706315-11706337 TTGGCGCCACTCACCCCTCAGGG 0: 1
1: 0
2: 1
3: 2
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134139559 Original CRISPR TTGGCGCCACTCACCCCTCA GGG Intronic
901089029 1:6629346-6629368 TCGGCTCCACTCTCCACTCACGG - Intronic
902733055 1:18382650-18382672 TGGGCTCCACTGACCCCTGAGGG + Intergenic
903761749 1:25703326-25703348 CCGGCTCCACTCACGCCTCAGGG - Intronic
905974779 1:42166206-42166228 TTGGCTACACACACCCATCAGGG - Intergenic
917710692 1:177681121-177681143 CTGGCTCCACTCACCCGTTAGGG - Intergenic
923576201 1:235161160-235161182 CGCGCGCCACTCACCCCTCCTGG + Exonic
923692330 1:236206833-236206855 TTGGCTCCTCTCACCCCTGCTGG - Intronic
1064653609 10:17534984-17535006 TTGTCGTCACTCACCAGTCAGGG - Intergenic
1070162909 10:73876422-73876444 TCTGCCCCACCCACCCCTCAGGG - Intergenic
1074679123 10:115885364-115885386 TTGGCGCCGCTCATCCCTGGTGG - Intronic
1077182067 11:1221161-1221183 TTGCCACCTGTCACCCCTCATGG - Intergenic
1078086698 11:8237770-8237792 CTGGTGCTGCTCACCCCTCAAGG + Intronic
1086894898 11:92300988-92301010 TTGGTGCCACTGACCTTTCATGG + Intergenic
1088378020 11:109162890-109162912 TTGGCGCCAATCACCTCCCATGG + Intergenic
1088417568 11:109606457-109606479 TTGGAGCCACTTCCCCTTCAGGG + Intergenic
1089500184 11:118927429-118927451 TTGGCACCATCAACCCCTCAAGG - Intronic
1095225564 12:39672987-39673009 TTGGAGTCCCTCAACCCTCATGG - Intronic
1096121115 12:49090055-49090077 TTCGCGCCGCTCACCGCGCACGG - Exonic
1098030272 12:66246520-66246542 TTGGCTCCACACAACTCTCACGG - Intronic
1099531254 12:83784434-83784456 TGGGCGCCACTAACCTCTCTGGG - Intergenic
1100886855 12:99080377-99080399 TTTGCTCCACTAATCCCTCAAGG - Intronic
1102281322 12:111621212-111621234 TTGGCTCTACTAACCCCTCCTGG + Intergenic
1122949483 14:105033812-105033834 ATGGCACCACTCACCCCTTTTGG + Intergenic
1124192566 15:27593288-27593310 CCGGCACCACTCACCTCTCATGG - Intergenic
1131905661 15:97139295-97139317 TTGTTGCCACTCTGCCCTCAAGG + Intergenic
1132568905 16:635558-635580 GTGGCACCACTCACCCTGCATGG - Intronic
1134139559 16:11706315-11706337 TTGGCGCCACTCACCCCTCAGGG + Intronic
1134172093 16:11976805-11976827 GGGCCGCCACTCACCGCTCATGG - Exonic
1137617955 16:49858023-49858045 GTGGCGCCACTCACCCGGGAGGG - Intergenic
1137825589 16:51491831-51491853 ATGCCCCCACACACCCCTCAAGG + Intergenic
1139952404 16:70678746-70678768 ATGGCGCCCCTCACCTCACAAGG + Intronic
1141288608 16:82696114-82696136 TTGGGGCCACTGACCCTTCTGGG + Intronic
1141353876 16:83324913-83324935 TTGGCCCCACTCACCTCTTCAGG + Intronic
1143724588 17:8836533-8836555 CTGGGGCCACTCACCTCTCCTGG + Exonic
1145978224 17:28996518-28996540 TGGGCTTCACTGACCCCTCAAGG - Intronic
1146486869 17:33249926-33249948 TTGGCCCCACTCACTTTTCAGGG - Intronic
1147629069 17:41918556-41918578 CTGGCGCGCCTCACCCCTCCCGG - Intronic
1157210578 18:45738838-45738860 TTGGTGCCACTCACTGCTCCTGG - Intronic
1161480197 19:4506520-4506542 ATGGCGCCCCCCACCCCCCAAGG + Intronic
1163249083 19:16115503-16115525 TCGGCGCCACTGCCTCCTCAGGG + Intronic
1164523161 19:28994353-28994375 TAGGTGCCACACACCCCACAGGG + Intergenic
1164703652 19:30303839-30303861 TGGCAGCCACTCACCACTCAGGG + Intronic
1165799303 19:38537832-38537854 TTGGCGCATCTGACCCCTCCTGG + Intronic
1166851623 19:45764135-45764157 CTCGCTCCCCTCACCCCTCATGG + Exonic
925058238 2:871796-871818 AGGGCGCCTGTCACCCCTCAGGG + Intergenic
926228603 2:10986046-10986068 CTGGCTCCCCTCACCCATCATGG - Intergenic
929581409 2:43083794-43083816 CTGCCCCCACGCACCCCTCAGGG + Intergenic
936834007 2:116684737-116684759 TTGGGGCCACTCATCCCTGAGGG + Intergenic
945114530 2:206398193-206398215 TTGCCTCCACTCAGCCCCCAGGG - Intergenic
1176371640 21:6065939-6065961 TGGGCCCCACACACCTCTCATGG + Intergenic
1179751879 21:43472600-43472622 TGGGCCCCACACACCTCTCATGG - Intergenic
1180157457 21:45984461-45984483 TGGGGGCCACTCACCCCACGAGG - Exonic
1181028780 22:20140227-20140249 TTGGGGCCACCCATCCCCCATGG - Intronic
1184355477 22:43976844-43976866 TTGGCTCCCCTCACCCTGCAGGG - Intronic
950724506 3:14907703-14907725 GTGGCGGCACTCACCCTTCCTGG - Exonic
952956956 3:38563445-38563467 TTGCCCCCACTCACCCCTCAAGG + Intronic
958709917 3:97705398-97705420 ATGGCGCCTCTCACATCTCATGG + Intronic
960965130 3:123099449-123099471 TCCTCCCCACTCACCCCTCAGGG + Intronic
966749503 3:183308687-183308709 TTGGAGACACACACCCCTAAAGG - Intronic
977212127 4:94230910-94230932 TTGGCCCCACCCTCACCTCAGGG - Intronic
988107536 5:26770731-26770753 GTGGCGGCACTCAACCATCAAGG + Intergenic
991301460 5:65133015-65133037 TGGGAGAGACTCACCCCTCAGGG - Intergenic
999341745 5:150778964-150778986 GTGGCCCCACTCACCCCAGATGG - Exonic
1005585860 6:27275893-27275915 GTGGCTCTACTCACCCTTCAGGG + Intergenic
1008602602 6:53110520-53110542 TTGGCACAACTCACTCCCCATGG - Intergenic
1013986395 6:116199107-116199129 TTAGCTCCCCTCACCCCCCAGGG - Intronic
1022095487 7:27138675-27138697 TTGGCCCCAGTCACCCCTTCTGG - Intronic
1023218040 7:37886448-37886470 TTGGCTCCACCCACCACTTACGG + Intronic
1040895540 8:52364750-52364772 TTGGTGTCACTCACCACCCATGG + Intronic
1044727328 8:95204112-95204134 CTGCCACCACTGACCCCTCAAGG - Intergenic
1044905100 8:96992054-96992076 TTGCTGCCACACACCCATCAAGG - Intronic
1056793349 9:89640145-89640167 TTGACGTCACTCATCCCCCACGG - Intergenic
1198361770 X:135902634-135902656 TTGGCAGCACTCAGCTCTCATGG + Intronic
1201927975 Y:19310962-19310984 TTGGGGCAACTCTGCCCTCATGG + Intergenic