ID: 1134139574

View in Genome Browser
Species Human (GRCh38)
Location 16:11706379-11706401
Sequence GCCCTGGGCCCTGTGATCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134139567_1134139574 26 Left 1134139567 16:11706330-11706352 CCTCAGGGAGGGAGGGTGCTCCT No data
Right 1134139574 16:11706379-11706401 GCCCTGGGCCCTGTGATCGTCGG No data
1134139565_1134139574 28 Left 1134139565 16:11706328-11706350 CCCCTCAGGGAGGGAGGGTGCTC No data
Right 1134139574 16:11706379-11706401 GCCCTGGGCCCTGTGATCGTCGG No data
1134139570_1134139574 6 Left 1134139570 16:11706350-11706372 CCTTGGCTGCTTGCTACAGAGGG 0: 1
1: 0
2: 0
3: 16
4: 174
Right 1134139574 16:11706379-11706401 GCCCTGGGCCCTGTGATCGTCGG No data
1134139566_1134139574 27 Left 1134139566 16:11706329-11706351 CCCTCAGGGAGGGAGGGTGCTCC No data
Right 1134139574 16:11706379-11706401 GCCCTGGGCCCTGTGATCGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134139574 Original CRISPR GCCCTGGGCCCTGTGATCGT CGG Intronic
No off target data available for this crispr