ID: 1134140573

View in Genome Browser
Species Human (GRCh38)
Location 16:11714723-11714745
Sequence ATTTGCTTGTAGAACTGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134140573_1134140576 5 Left 1134140573 16:11714723-11714745 CCGACTCAGTTCTACAAGCAAAT 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1134140576 16:11714751-11714773 CAGCATCAGACGCCACCTGGTGG No data
1134140573_1134140581 26 Left 1134140573 16:11714723-11714745 CCGACTCAGTTCTACAAGCAAAT 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1134140581 16:11714772-11714794 GGAGTACAGGGACACTACGCTGG No data
1134140573_1134140575 2 Left 1134140573 16:11714723-11714745 CCGACTCAGTTCTACAAGCAAAT 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1134140575 16:11714748-11714770 CGGCAGCATCAGACGCCACCTGG No data
1134140573_1134140577 13 Left 1134140573 16:11714723-11714745 CCGACTCAGTTCTACAAGCAAAT 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1134140577 16:11714759-11714781 GACGCCACCTGGTGGAGTACAGG No data
1134140573_1134140578 14 Left 1134140573 16:11714723-11714745 CCGACTCAGTTCTACAAGCAAAT 0: 1
1: 0
2: 0
3: 14
4: 164
Right 1134140578 16:11714760-11714782 ACGCCACCTGGTGGAGTACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134140573 Original CRISPR ATTTGCTTGTAGAACTGAGT CGG (reversed) Intronic
904094990 1:27969657-27969679 ATTTGTATTTATAACTGAGTAGG + Intergenic
904516911 1:31063139-31063161 ATTTCCTTTTAGAACAGAATGGG - Intronic
905025269 1:34845393-34845415 ATTTACTTGTCTGACTGAGTTGG - Intronic
905385459 1:37600461-37600483 ATTTGCTTGTAAAACTGTTGAGG - Intergenic
905950853 1:41949334-41949356 AATAGTTTGTAGAACTGAGTAGG - Intronic
907071153 1:51536111-51536133 ATTTGATTGTCATACTGAGTGGG - Intergenic
909419550 1:75448936-75448958 ATGTGATTGCAGTACTGAGTGGG - Intronic
909822190 1:80079902-80079924 ATGTGCTTATAGAGCTAAGTAGG + Intergenic
911869407 1:103075650-103075672 ACTGGCTTGCAGAATTGAGTGGG - Intronic
918487843 1:185047941-185047963 ATTTGCATTTAATACTGAGTAGG + Intronic
919702374 1:200643908-200643930 ATGTGCTTGTGGAACTGTGGGGG + Intronic
921446563 1:215254142-215254164 AGTTGCTTGATGAACTGAGATGG + Intergenic
923432440 1:233936316-233936338 GTTTACTTGTTGAACTGAGCTGG - Intronic
1064937237 10:20691755-20691777 AAATGCTTGTTGAACTGAATTGG - Intergenic
1065811024 10:29443957-29443979 ATTTCCTTGTAGTACTTAATTGG - Intergenic
1066746814 10:38609520-38609542 ATTTCCTTGTAGTACTGCTTGGG - Intergenic
1069165609 10:65154310-65154332 ATTTGCTTGAATATCTGAATAGG + Intergenic
1072303659 10:94086242-94086264 AATTGCCTTTAGAACTGATTTGG + Intronic
1072504664 10:96053125-96053147 ATTTGCTTCTAGAACTTACAAGG - Intronic
1074878885 10:117636140-117636162 AATTGCTTGTAAATCTGAGCAGG + Intergenic
1078261016 11:9708865-9708887 AACTGCTTGTAGAACTCAGTAGG - Intronic
1079508985 11:21188065-21188087 CTTTACTTTTAGAACTGATTTGG + Intronic
1080734287 11:34996589-34996611 AATGGCTTGTTAAACTGAGTTGG - Intronic
1080930978 11:36810143-36810165 ATCTGCTTATATTACTGAGTTGG - Intergenic
1085151409 11:74255262-74255284 ATTTGGTGGTAGACCTGAGGTGG - Intronic
1085607469 11:77915238-77915260 ATTTTCTTGTTGAACTGTGAAGG + Intronic
1088588701 11:111381777-111381799 ATTTGCTGGAAGAAATGAGCTGG - Intronic
1088862956 11:113819510-113819532 ATTAGGTAGTAGAACTGAGATGG - Intronic
1088989476 11:114939429-114939451 GGTTGCTTTGAGAACTGAGTAGG + Intergenic
1089459511 11:118644421-118644443 AACTGCTTGTTGACCTGAGTCGG + Intronic
1090264529 11:125345680-125345702 TGTTGCTGGTAGAACGGAGTTGG - Intronic
1090516287 11:127431273-127431295 TTTTGCTTGTTGAATTGTGTAGG + Intergenic
1090565537 11:127988087-127988109 ATTTTCTTGAAGAACTAAGAAGG + Intergenic
1091634581 12:2187402-2187424 ATTTGCATGAGGAACTGAGGTGG + Intronic
1099246584 12:80199999-80200021 ATGTGCTTATAGAGCTCAGTGGG - Intergenic
1101094253 12:101319915-101319937 ATTAGCTTTTAGAAGGGAGTAGG + Intronic
1103648963 12:122418421-122418443 CTTTTCTTGTAGAAATGAGATGG - Intronic
1106794041 13:33185990-33186012 GTTTGCATGGAGAACTGAGGAGG + Intronic
1109078491 13:57867546-57867568 ATTTGCTTATGGAGCTCAGTTGG - Intergenic
1109963530 13:69662385-69662407 ATTGACTAGTAGAAATGAGTTGG + Intergenic
1111757608 13:92418361-92418383 ATTTGCTGATAGCACAGAGTTGG + Intronic
1115872402 14:37819770-37819792 ATTTATTTGTACAACTCAGTAGG + Intronic
1118945865 14:70386978-70387000 GTTTTCTTTTAGAACTGAATAGG - Intronic
1120718068 14:87861578-87861600 GTTTGATTATTGAACTGAGTGGG - Intronic
1121723138 14:96126065-96126087 ATTTTCTTGTAGAAATGAGCTGG - Intergenic
1124796131 15:32782134-32782156 ATTTCATCTTAGAACTGAGTAGG + Intronic
1128397235 15:67240573-67240595 GTTTGCTACTAGAACTGGGTTGG - Intronic
1134140573 16:11714723-11714745 ATTTGCTTGTAGAACTGAGTCGG - Intronic
1136123237 16:28155761-28155783 ATTTGCTTGCAGGTCTGAGGTGG - Intronic
1138878267 16:60979352-60979374 CTTTGCTTGGAGATCAGAGTGGG - Intergenic
1141335271 16:83148395-83148417 ATTTGCTGGAAGAACTAAGACGG + Intronic
1149138707 17:53402914-53402936 TTTTGCTTTCAGAACTGAGAAGG + Intergenic
1150580210 17:66466434-66466456 ACTTGCTTGTGGAGCTGAGATGG + Intronic
1150886748 17:69095480-69095502 AATTTCTTGTAGAAGTCAGTGGG + Intronic
1150950625 17:69799503-69799525 ATTTCAATGTAGAATTGAGTGGG - Intergenic
1153600003 18:6771211-6771233 ATTTTTTTGTAGAGATGAGTGGG + Intronic
1159773110 18:72571687-72571709 ATTTCCCTGTATAACTGAATAGG - Intronic
1161686543 19:5705577-5705599 ATTTCCTTGTAGAATGGAGATGG + Intronic
1166563984 19:43752362-43752384 AACTGTTTGTAGAACTCAGTGGG + Intronic
925886852 2:8400983-8401005 ATTTGCATGCAGAACTTTGTAGG - Intergenic
927630291 2:24767387-24767409 AGTTGTTCGTAGAACTGATTAGG - Intronic
930476928 2:51893211-51893233 CTTTGCTTGTAAAGCTTAGTTGG - Intergenic
931563629 2:63590216-63590238 TTTTGCTTTTAGAACTGAATGGG + Intronic
932201698 2:69833825-69833847 ATCTGGTTGTAGAACAGTGTGGG - Intronic
934187413 2:89759239-89759261 ATTTCCTTGTAGTACTGCTTGGG + Intergenic
934309218 2:91848699-91848721 ATTTCCTTGTAGTACTGCTTGGG - Intergenic
937000455 2:118461220-118461242 ATTTGTTTGAAGAGTTGAGTTGG - Intergenic
938845304 2:135202426-135202448 CTTTGCATGTTGAACTGAGTTGG + Intronic
940035289 2:149306379-149306401 ATTTTCTGGTAGGTCTGAGTGGG + Intergenic
942975068 2:182006932-182006954 ATTTCCTTGTATAACTGGTTAGG + Intronic
943085975 2:183311697-183311719 ATTTGCTTTTGGAAGTGTGTTGG + Intergenic
944317784 2:198301906-198301928 CTTTGCCTGTAGAACCAAGTTGG - Intronic
945257129 2:207812190-207812212 ATATGCTTGTAAGTCTGAGTTGG + Intergenic
946056645 2:216908601-216908623 ACTTGCTTGGAGAACTGCATGGG + Intergenic
946593730 2:221281876-221281898 TTTTTCTTGTTGAACAGAGTGGG + Intergenic
947510125 2:230744922-230744944 ATTTGCTTAGAGAAAAGAGTGGG - Intronic
948298016 2:236877749-236877771 TTTCGCTTGTAAAACTCAGTAGG - Intergenic
948985577 2:241520635-241520657 ATTTACTTGTAAGACTGAGGTGG + Intergenic
1170433550 20:16299474-16299496 ATTGGCTAGTATAACAGAGTTGG + Intronic
1173339958 20:42144186-42144208 ATTAGTTTGAAGAACTGAGGGGG + Intronic
1173438568 20:43055069-43055091 AATTGCTTGTAGTAATTAGTGGG - Intronic
1175089470 20:56489922-56489944 GTTTGCCTGTAGAAATGTGTGGG + Intronic
1175650781 20:60720472-60720494 AGTTGCTTGCAGAAATGACTTGG - Intergenic
1175749617 20:61486228-61486250 ATCTGTTTGTAGAACTGTGCAGG - Intronic
1175752168 20:61506642-61506664 ATTTACTTATAGAGATGAGTCGG + Intronic
1176011340 20:62897950-62897972 ACTTGCCTGTAGAGCTGAGATGG - Intronic
1177225897 21:18255568-18255590 ATTTGGATGGAGACCTGAGTAGG - Intronic
1177721281 21:24909983-24910005 CTTTGCTTGGTGAACTGAGTGGG - Intergenic
1178722373 21:35021615-35021637 TTTTGCTTGTAGAGTTGAGTTGG + Intronic
1179440962 21:41393890-41393912 ATTTGGCTTTAGAACTGGGTGGG - Intronic
1184357007 22:43988752-43988774 ATTTGCAGGTGGAAGTGAGTTGG + Intronic
1185394496 22:50579726-50579748 ATTTGCTGGTAGAAGTCAGTCGG - Exonic
949124222 3:426414-426436 ACTGGCTTGCAGAAATGAGTAGG + Intergenic
949275929 3:2281119-2281141 ATTAGCTTTTAGAAATGAGGAGG - Intronic
949833187 3:8239084-8239106 ATTTGCTTGTGCGAGTGAGTTGG + Intergenic
952044343 3:29299959-29299981 ATTTGCTTGTACGACTCAATAGG + Intronic
954234333 3:49244675-49244697 ATTGGCTTCTTGAACTGAGATGG - Exonic
956482437 3:69686741-69686763 ATTTGATTGCAAAACTCAGTAGG + Intergenic
958632587 3:96701748-96701770 ATTTGCATGAGGGACTGAGTTGG + Intergenic
959565997 3:107833853-107833875 ATGTGCTTTCAGAACTGCGTGGG - Intergenic
960748617 3:120919377-120919399 ATATACTTGAAGAACTGAGTTGG + Intronic
960991570 3:123314936-123314958 TTTTGCTTGTTGAACTGGCTAGG - Intronic
961321067 3:126076618-126076640 CTTTGCTTCTTGAACTTAGTGGG - Intronic
963648062 3:147942715-147942737 ATTTACTTGGAGAACTGATGAGG + Intergenic
964739190 3:159947874-159947896 CTTTTCTTGTAGAAACGAGTTGG - Intergenic
964820710 3:160765898-160765920 ATTTGTTTATAATACTGAGTTGG + Intronic
965022272 3:163247787-163247809 ATTTGGATGTAGAATTGAGGAGG + Intergenic
965904535 3:173687168-173687190 CTATGTTTGTAGAACCGAGTTGG + Intronic
966273548 3:178137771-178137793 ATTTGCTTGTATATCTATGTTGG - Intergenic
966300728 3:178476745-178476767 ATTTGATTGTAGCAATTAGTGGG + Intronic
970352715 4:15219786-15219808 ATTTGCAAAAAGAACTGAGTTGG + Intergenic
970384808 4:15545622-15545644 TTCTGCTTGTAGAACTGCCTTGG - Intronic
972491336 4:39590324-39590346 AATTGCTTGTGGAATTGAGGTGG + Intronic
975715319 4:77199928-77199950 ATTAGCTTGTATAACAGACTTGG + Intronic
975875603 4:78832947-78832969 ATTTCCCAGTAGAACAGAGTAGG + Intronic
976412470 4:84731244-84731266 ATTTGATGGTAGAATTCAGTGGG + Intronic
978021487 4:103818635-103818657 ATCCGCTTTTAAAACTGAGTGGG - Intergenic
978770819 4:112455042-112455064 TTGTGGTTGTAGAACTGAGGTGG + Intergenic
978970898 4:114805012-114805034 ATTTTATTTTAGAACTGAATAGG - Intergenic
980549422 4:134314704-134314726 ATTTGCTGGTAAAATTAAGTTGG - Intergenic
984138557 4:175973516-175973538 ATTAGCATGTATGACTGAGTTGG - Intronic
986194339 5:5524363-5524385 ATGTGCTTGTAGACGTGTGTGGG - Intergenic
986409136 5:7459170-7459192 ATTTGCTTGCAGAATTGGCTTGG - Intronic
986487061 5:8248413-8248435 AATGGCTTGTAGAAGAGAGTAGG + Intergenic
986887036 5:12251914-12251936 TTTTGATTGTAGAGCTAAGTTGG - Intergenic
987561460 5:19528119-19528141 ATTTTCTTATATAATTGAGTGGG - Intronic
988809778 5:34773002-34773024 ATTTGCTTATAAAACTCAGCTGG - Intronic
990173192 5:53078090-53078112 CTTTGCTTGCAGAACTTAGTTGG + Intronic
992450095 5:76868464-76868486 ATTTACTCGGAGAACTCAGTTGG - Intronic
993667148 5:90713408-90713430 ATTTTCTTGTAGAACATAGTGGG + Intronic
994652854 5:102550782-102550804 ATTTGTTTGTAAATCAGAGTAGG - Intergenic
998667060 5:144309416-144309438 AATTGCTTGTAAAACTCAGGCGG + Intronic
1000745688 5:165030699-165030721 AATTTCTTGCACAACTGAGTAGG - Intergenic
1001611603 5:173007345-173007367 ATGTGCTTATAGAACTGAGATGG + Intronic
1002599660 5:180346972-180346994 ATCTCCTTGCAGAACTGAGAGGG + Intronic
1003360753 6:5423036-5423058 ATTTGCTTCTAGATCTGTGCTGG + Intronic
1004112583 6:12733987-12734009 CTTTGTATGTTGAACTGAGTTGG - Intronic
1005569416 6:27130255-27130277 CTTTGCTTGAAAAACTGAATGGG - Intronic
1008922736 6:56860031-56860053 ATTTGTTTTTAAAAATGAGTAGG - Intronic
1009285645 6:61813694-61813716 TTCTGCTAGTAGAACTGAGCAGG - Intronic
1011132910 6:84070702-84070724 AATTACTTATAGAACTAAGTGGG - Intronic
1012859515 6:104542844-104542866 ATTTGCTTATAGAATTGGGAGGG - Intergenic
1013782924 6:113748622-113748644 ATTTGCTTTTATAACTGGATTGG + Intergenic
1014035708 6:116765201-116765223 ATTTTCTTGTCGAACTGCGAAGG + Exonic
1014960658 6:127679921-127679943 ATTTGATTGTAGAAAGGAGGTGG + Intergenic
1015304007 6:131685701-131685723 TTTAGCATTTAGAACTGAGTAGG - Intronic
1015840159 6:137468088-137468110 ATTTGCTTGTGGTGCTGACTGGG - Intergenic
1018420342 6:163635323-163635345 ACCTGCATGTACAACTGAGTAGG + Intergenic
1022581689 7:31561471-31561493 ATTTGCTGATAGAAATGATTTGG + Intronic
1025845483 7:65192691-65192713 ATTTTCTTGTTGAACTGTGAAGG - Intergenic
1025895760 7:65698723-65698745 ATTTTCTTGTTGAACTGTGAAGG - Intergenic
1027641110 7:80734962-80734984 ATTTGCTTGTTGAATTGTTTGGG - Intergenic
1027841404 7:83316917-83316939 ATTTATTAGTAGAACTGATTTGG - Intergenic
1028789927 7:94842459-94842481 TTTTGGTTGTTGAACTGAGTGGG + Intergenic
1029143008 7:98424940-98424962 ATTTTCTTGTAGAGATGAGAGGG + Intergenic
1030690462 7:112527395-112527417 ATTTGCATGTCCAACTGAGACGG + Intergenic
1032207141 7:129876839-129876861 ATTTGCATCTATAAATGAGTGGG - Intronic
1033639436 7:143247007-143247029 AATTCCTTGTAGAACTGACAGGG + Intronic
1034000860 7:147411439-147411461 ATTTGCCTGGAAAACTGATTGGG - Intronic
1035168387 7:157004788-157004810 ATTTGCTTGTAGAAATGATGGGG - Intronic
1035745276 8:1957805-1957827 ATTTGCTTTCAGAAGTGAGCTGG + Exonic
1037833782 8:22204418-22204440 ATCAGCTTGTAAATCTGAGTCGG + Intronic
1042099028 8:65253801-65253823 ATTTGCATCTATAAATGAGTAGG - Intergenic
1042966334 8:74357618-74357640 ACTTGCCGGAAGAACTGAGTAGG - Intronic
1044281891 8:90366176-90366198 ATTTACATGTGGAACTGACTGGG - Intergenic
1045043048 8:98244856-98244878 ACTTGCCTGTAGACCAGAGTTGG - Intronic
1046035025 8:108830328-108830350 AATTGTTTGCAGAATTGAGTTGG + Intergenic
1047822988 8:128541834-128541856 ATTTTCTTGCAGATTTGAGTTGG - Intergenic
1048127429 8:131651683-131651705 AGTTTATTGTAGAACTGTGTAGG - Intergenic
1051128392 9:13832014-13832036 TTTTGGGTGGAGAACTGAGTAGG - Intergenic
1052891960 9:33709783-33709805 AATTTCTTCTAGAACTGAGCTGG + Intergenic
1057116004 9:92522960-92522982 ATTTGCTTGTATGCCTCAGTAGG + Intronic
1057346106 9:94251981-94252003 ATTTGCTTCAAAGACTGAGTTGG - Intergenic
1192808583 X:74530749-74530771 ATTAGCTTCTGGAAGTGAGTAGG + Intronic
1194040131 X:88930637-88930659 AATTTCTTGTAGAGCTGATTTGG + Intergenic
1195430430 X:104783168-104783190 ATTTGAATGTAGATGTGAGTGGG + Intronic
1199329739 X:146544767-146544789 ATTTTATTAAAGAACTGAGTTGG + Intergenic
1199603993 X:149561984-149562006 ATTTTGTTTTAGAACAGAGTTGG - Intergenic
1199646396 X:149917490-149917512 ATTTTGTTTTAGAACAGAGTTGG + Intergenic