ID: 1134143619

View in Genome Browser
Species Human (GRCh38)
Location 16:11742796-11742818
Sequence GCTGCGGGATTGGGGAGCAA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134143619_1134143633 30 Left 1134143619 16:11742796-11742818 CCGTTGCTCCCCAATCCCGCAGC 0: 1
1: 0
2: 1
3: 17
4: 237
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143619_1134143625 -2 Left 1134143619 16:11742796-11742818 CCGTTGCTCCCCAATCCCGCAGC 0: 1
1: 0
2: 1
3: 17
4: 237
Right 1134143625 16:11742817-11742839 GCTCGCCGCACCCGCTAACCCGG 0: 1
1: 0
2: 0
3: 1
4: 34
1134143619_1134143632 29 Left 1134143619 16:11742796-11742818 CCGTTGCTCCCCAATCCCGCAGC 0: 1
1: 0
2: 1
3: 17
4: 237
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134143619 Original CRISPR GCTGCGGGATTGGGGAGCAA CGG (reversed) Exonic