ID: 1134143626

View in Genome Browser
Species Human (GRCh38)
Location 16:11742822-11742844
Sequence AGCGTCCGGGTTAGCGGGTG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 65
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134143626_1134143634 5 Left 1134143626 16:11742822-11742844 CCGCACCCGCTAACCCGGACGCT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1134143634 16:11742850-11742872 TCAGCCGCGCCGCCGCCGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 152
1134143626_1134143632 3 Left 1134143626 16:11742822-11742844 CCGCACCCGCTAACCCGGACGCT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160
1134143626_1134143633 4 Left 1134143626 16:11742822-11742844 CCGCACCCGCTAACCCGGACGCT 0: 1
1: 0
2: 0
3: 0
4: 64
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134143626 Original CRISPR AGCGTCCGGGTTAGCGGGTG CGG (reversed) Exonic