ID: 1134143628

View in Genome Browser
Species Human (GRCh38)
Location 16:11742828-11742850
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 20
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 19}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1134143628_1134143634 -1 Left 1134143628 16:11742828-11742850 CCGCTAACCCGGACGCTCCACGT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1134143634 16:11742850-11742872 TCAGCCGCGCCGCCGCCGCGGGG 0: 1
1: 0
2: 1
3: 14
4: 152
1134143628_1134143633 -2 Left 1134143628 16:11742828-11742850 CCGCTAACCCGGACGCTCCACGT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1134143633 16:11742849-11742871 GTCAGCCGCGCCGCCGCCGCGGG 0: 1
1: 0
2: 2
3: 31
4: 201
1134143628_1134143632 -3 Left 1134143628 16:11742828-11742850 CCGCTAACCCGGACGCTCCACGT 0: 1
1: 0
2: 0
3: 0
4: 19
Right 1134143632 16:11742848-11742870 CGTCAGCCGCGCCGCCGCCGCGG 0: 1
1: 0
2: 3
3: 20
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1134143628 Original CRISPR ACGTGGAGCGTCCGGGTTAG CGG (reversed) Exonic